ID: 1146184693

View in Genome Browser
Species Human (GRCh38)
Location 17:30717236-30717258
Sequence AGGCCAGGAGGCAACCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146184689_1146184693 -6 Left 1146184689 17:30717219-30717241 CCAGGAGGCCAGAAGGGAGGCCA No data
Right 1146184693 17:30717236-30717258 AGGCCAGGAGGCAACCAGCAAGG No data
1146184683_1146184693 16 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184693 17:30717236-30717258 AGGCCAGGAGGCAACCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146184693 Original CRISPR AGGCCAGGAGGCAACCAGCA AGG Intergenic