ID: 1146184696

View in Genome Browser
Species Human (GRCh38)
Location 17:30717242-30717264
Sequence GGAGGCAACCAGCAAGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146184683_1146184696 22 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184696 17:30717242-30717264 GGAGGCAACCAGCAAGGTGAGGG No data
1146184689_1146184696 0 Left 1146184689 17:30717219-30717241 CCAGGAGGCCAGAAGGGAGGCCA No data
Right 1146184696 17:30717242-30717264 GGAGGCAACCAGCAAGGTGAGGG No data
1146184692_1146184696 -8 Left 1146184692 17:30717227-30717249 CCAGAAGGGAGGCCAGGAGGCAA No data
Right 1146184696 17:30717242-30717264 GGAGGCAACCAGCAAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146184696 Original CRISPR GGAGGCAACCAGCAAGGTGA GGG Intergenic