ID: 1146184697

View in Genome Browser
Species Human (GRCh38)
Location 17:30717250-30717272
Sequence GCTTCTGGCCCTCACCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146184697_1146184704 27 Left 1146184697 17:30717250-30717272 CCAGCAAGGTGAGGGCCAGAAGC No data
Right 1146184704 17:30717300-30717322 TTCTGGCTTTGACAGCCCTGTGG No data
1146184697_1146184698 -10 Left 1146184697 17:30717250-30717272 CCAGCAAGGTGAGGGCCAGAAGC No data
Right 1146184698 17:30717263-30717285 GGCCAGAAGCAGCCAGCACTTGG No data
1146184697_1146184702 3 Left 1146184697 17:30717250-30717272 CCAGCAAGGTGAGGGCCAGAAGC No data
Right 1146184702 17:30717276-30717298 CAGCACTTGGTGGAAGCTTCAGG No data
1146184697_1146184703 10 Left 1146184697 17:30717250-30717272 CCAGCAAGGTGAGGGCCAGAAGC No data
Right 1146184703 17:30717283-30717305 TGGTGGAAGCTTCAGGTTTCTGG No data
1146184697_1146184700 -7 Left 1146184697 17:30717250-30717272 CCAGCAAGGTGAGGGCCAGAAGC No data
Right 1146184700 17:30717266-30717288 CAGAAGCAGCCAGCACTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146184697 Original CRISPR GCTTCTGGCCCTCACCTTGC TGG (reversed) Intergenic