ID: 1146184700

View in Genome Browser
Species Human (GRCh38)
Location 17:30717266-30717288
Sequence CAGAAGCAGCCAGCACTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146184694_1146184700 4 Left 1146184694 17:30717239-30717261 CCAGGAGGCAACCAGCAAGGTGA No data
Right 1146184700 17:30717266-30717288 CAGAAGCAGCCAGCACTTGGTGG No data
1146184697_1146184700 -7 Left 1146184697 17:30717250-30717272 CCAGCAAGGTGAGGGCCAGAAGC No data
Right 1146184700 17:30717266-30717288 CAGAAGCAGCCAGCACTTGGTGG No data
1146184689_1146184700 24 Left 1146184689 17:30717219-30717241 CCAGGAGGCCAGAAGGGAGGCCA No data
Right 1146184700 17:30717266-30717288 CAGAAGCAGCCAGCACTTGGTGG No data
1146184692_1146184700 16 Left 1146184692 17:30717227-30717249 CCAGAAGGGAGGCCAGGAGGCAA No data
Right 1146184700 17:30717266-30717288 CAGAAGCAGCCAGCACTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146184700 Original CRISPR CAGAAGCAGCCAGCACTTGG TGG Intergenic