ID: 1146184703

View in Genome Browser
Species Human (GRCh38)
Location 17:30717283-30717305
Sequence TGGTGGAAGCTTCAGGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146184694_1146184703 21 Left 1146184694 17:30717239-30717261 CCAGGAGGCAACCAGCAAGGTGA No data
Right 1146184703 17:30717283-30717305 TGGTGGAAGCTTCAGGTTTCTGG No data
1146184699_1146184703 -5 Left 1146184699 17:30717265-30717287 CCAGAAGCAGCCAGCACTTGGTG No data
Right 1146184703 17:30717283-30717305 TGGTGGAAGCTTCAGGTTTCTGG No data
1146184697_1146184703 10 Left 1146184697 17:30717250-30717272 CCAGCAAGGTGAGGGCCAGAAGC No data
Right 1146184703 17:30717283-30717305 TGGTGGAAGCTTCAGGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146184703 Original CRISPR TGGTGGAAGCTTCAGGTTTC TGG Intergenic