ID: 1146187184

View in Genome Browser
Species Human (GRCh38)
Location 17:30731719-30731741
Sequence CAGGAGGAGAGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5818
Summary {0: 1, 1: 7, 2: 81, 3: 829, 4: 4900}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146187184_1146187203 30 Left 1146187184 17:30731719-30731741 CCTCCTTCCCTCCTCTCCTCCTG 0: 1
1: 7
2: 81
3: 829
4: 4900
Right 1146187203 17:30731772-30731794 TCCTTCTCCCCTCGGTCAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 120
1146187184_1146187201 22 Left 1146187184 17:30731719-30731741 CCTCCTTCCCTCCTCTCCTCCTG 0: 1
1: 7
2: 81
3: 829
4: 4900
Right 1146187201 17:30731764-30731786 CTCTCTCCTCCTTCTCCCCTCGG 0: 1
1: 2
2: 10
3: 105
4: 860

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146187184 Original CRISPR CAGGAGGAGAGGAGGGAAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr