ID: 1146188522

View in Genome Browser
Species Human (GRCh38)
Location 17:30744695-30744717
Sequence GTGGTCAGGAGAAAAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146188522_1146188529 22 Left 1146188522 17:30744695-30744717 CCTGCTTCTTTTCTCCTGACCAC No data
Right 1146188529 17:30744740-30744762 ATTTCAGGGTTCAAGTGAGAAGG No data
1146188522_1146188525 7 Left 1146188522 17:30744695-30744717 CCTGCTTCTTTTCTCCTGACCAC No data
Right 1146188525 17:30744725-30744747 GTTTGCCCTATAGTCATTTCAGG No data
1146188522_1146188526 8 Left 1146188522 17:30744695-30744717 CCTGCTTCTTTTCTCCTGACCAC No data
Right 1146188526 17:30744726-30744748 TTTGCCCTATAGTCATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146188522 Original CRISPR GTGGTCAGGAGAAAAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr