ID: 1146200508

View in Genome Browser
Species Human (GRCh38)
Location 17:30853391-30853413
Sequence ATGTCTCTATAGCAGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146200508 Original CRISPR ATGTCTCTATAGCAGAAGGT AGG (reversed) Intronic
901466303 1:9423509-9423531 ATTTCTCTACAGCACATGGTTGG + Intergenic
904953061 1:34259998-34260020 AAGACTCTTTAGAAGAAGGTAGG - Intergenic
907182918 1:52586582-52586604 CTGTCTCTCAATCAGAAGGTGGG + Intergenic
912267971 1:108178269-108178291 ATTTGTCTATTGCTGAAGGTAGG - Intronic
912498950 1:110109160-110109182 ATCTCTCTAGGGCAGGAGGTGGG + Intergenic
915445930 1:155974985-155975007 ATGTCTCTTTGGGAGAGGGTGGG - Intronic
918532774 1:185541400-185541422 ATGTGGTTATAGCAGAAGGCTGG + Intergenic
922856446 1:228779074-228779096 ATGTCTCAATACCATAATGTAGG + Intergenic
923128497 1:231054325-231054347 AGGTCTCTAGAGTAGAAGGGAGG - Intergenic
1063772865 10:9224155-9224177 ATCTCTCTGTACCAGGAGGTGGG + Intergenic
1068117634 10:52751927-52751949 AGGTACCTATATCAGAAGGTTGG - Intergenic
1068366756 10:56060827-56060849 ATGTCTTTATAGCAGCAAGCAGG + Intergenic
1068884222 10:62081771-62081793 ATTTCTCTACAGCAGAAGTCAGG - Intronic
1070289731 10:75106303-75106325 ATGTTTCTCGAGCTGAAGGTGGG - Intronic
1072482068 10:95818603-95818625 ATATCACTATAGAAGAAGGTGGG + Intronic
1079338186 11:19589646-19589668 ATGTATCTAGAGCAGCAGGTGGG + Intronic
1079623898 11:22592348-22592370 GTCTTTCTAGAGCAGAAGGTAGG - Intergenic
1083106598 11:60364321-60364343 CTGTCACTATAGGAGAAGGAAGG + Intronic
1084593310 11:70102881-70102903 AATTCCCTTTAGCAGAAGGTGGG - Intronic
1084795585 11:71502529-71502551 CTGTCTGGATAGCAGAAAGTGGG + Intronic
1088006609 11:104948666-104948688 ATGTCTCCATAGCAAACCGTGGG - Exonic
1088769835 11:113022951-113022973 ATATCTCTTTAGCAGAAACTTGG + Intronic
1090282525 11:125468524-125468546 ATTTCTTTATAGTAGAAGGTGGG + Intronic
1091367208 11:135032362-135032384 AAGTCTCTGTAGCAGAGGGGAGG - Intergenic
1095554013 12:43478672-43478694 ATTTCTCAATAGCAAAAGGCAGG + Intronic
1096203555 12:49703780-49703802 ATGTGTCTAGAACAGAAGGCTGG + Intronic
1101176971 12:102162456-102162478 AGGATTCTAGAGCAGAAGGTGGG + Intronic
1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG + Intergenic
1106451352 13:29885662-29885684 ATGTATGTATAAGAGAAGGTAGG + Intergenic
1106482475 13:30147316-30147338 ATTTCTCAAGAGCAGAAGGGAGG - Intergenic
1110916509 13:81028004-81028026 ATGTCTTTATAGCTGAAGTGTGG + Intergenic
1111352957 13:87056568-87056590 GTGTCTATATAGCAGAAAATAGG - Intergenic
1115805190 14:37043088-37043110 TTGTGTCTGTGGCAGAAGGTGGG - Intronic
1119527389 14:75333586-75333608 ATGTGTCTTTAGCAGAAGAGGGG + Intergenic
1123436780 15:20260386-20260408 ATGTTTCTATAGCCGATGGTTGG - Intergenic
1123894215 15:24812038-24812060 ATGTCTCCATAGAATAAGGGTGG + Intergenic
1130670892 15:85911542-85911564 CTGTCTCTGTCACAGAAGGTAGG + Intergenic
1131108288 15:89749268-89749290 ATGTCTCTAAGCCACAAGGTGGG + Exonic
1132685251 16:1159409-1159431 ATGTCTGTATAGCAGATGAGAGG + Intronic
1139067094 16:63330560-63330582 ATGTAACTAAGGCAGAAGGTGGG + Intergenic
1141372312 16:83499459-83499481 ATGTTTCTCTAGCACAAGGCTGG - Intronic
1146200508 17:30853391-30853413 ATGTCTCTATAGCAGAAGGTAGG - Intronic
1149218104 17:54382466-54382488 ATGATTATATAGCAAAAGGTAGG + Intergenic
1149380362 17:56087465-56087487 AGGTATCTAGAGCAGAAGGCAGG - Intergenic
1149645199 17:58235845-58235867 ATGTCTCTCTAGCAGACAGGAGG - Intronic
1153336584 18:3931519-3931541 TTGTCTCAATAGGATAAGGTAGG + Intronic
1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG + Intronic
1154099454 18:11456467-11456489 ATCTCTCTAAAGTAGAATGTTGG + Intergenic
1156587044 18:38442808-38442830 ATGGCTCTATTTCAGAATGTAGG - Intergenic
1156707533 18:39901072-39901094 CTCTCTCTAGAGCAGATGGTAGG + Intergenic
1156721532 18:40076101-40076123 GTGTCTTTATATTAGAAGGTAGG - Intergenic
1164468039 19:28504950-28504972 CTACCTCTAGAGCAGAAGGTGGG - Intergenic
1164966050 19:32485102-32485124 GTGTCTTTATATCAGAAGATCGG + Exonic
1165421235 19:35722978-35723000 ATGTATCTATTGCAGCAGGCAGG - Exonic
1167888423 19:52520775-52520797 ATGTTTCTGTAGCACAGGGTTGG + Intergenic
1168590898 19:57633505-57633527 ACGTCTCTGTAGCACAGGGTCGG + Intronic
927506467 2:23618247-23618269 ATGTCTTTGTAGTAGATGGTGGG + Intronic
927718687 2:25369275-25369297 TTGTCTCTGCAGCACAAGGTAGG - Intergenic
928690405 2:33793005-33793027 AAGGGTCTATAGCAGAAGGGCGG - Intergenic
931231668 2:60380319-60380341 ATGTCTTTATATCAGAAGTAGGG - Intergenic
936841176 2:116771459-116771481 ATTTTTCTATGGCATAAGGTAGG + Intergenic
937304746 2:120864404-120864426 GTGTCTCGATGGCTGAAGGTAGG + Intronic
937495786 2:122417683-122417705 ATGTTTCTATAAGAAAAGGTAGG - Intergenic
940010522 2:149049989-149050011 TTGTTTCTATAGCAGAGGATAGG + Intronic
945699845 2:213155598-213155620 GGGTCTTTTTAGCAGAAGGTGGG + Intergenic
1170644965 20:18189855-18189877 TTGTCTCTTTAGCGGAGGGTGGG + Intergenic
1170676505 20:18486445-18486467 ATGTCTTTATAGCTAAAGATTGG + Intergenic
1171069137 20:22049415-22049437 ATGTGTGTATAGGAGAAGGATGG - Intergenic
1177422358 21:20876645-20876667 ATGTCAATGAAGCAGAAGGTTGG - Intergenic
1177735944 21:25090349-25090371 ACCTTTCTATAGCATAAGGTTGG - Intergenic
1178514284 21:33232777-33232799 ATTTCTCTAGCCCAGAAGGTTGG - Intronic
1179555620 21:42173581-42173603 ATGACTCTATCACAGAAGATAGG + Intergenic
949473921 3:4424234-4424256 GTGTGTGTATAGCAGAGGGTGGG - Intronic
950038871 3:9906804-9906826 ATGTCTCTGGATCCGAAGGTTGG - Exonic
956246052 3:67184917-67184939 ATGTGTATATGGCAGATGGTGGG - Intergenic
957379236 3:79403884-79403906 ATCTCTCTGTGGCAGAAGCTGGG + Intronic
957430783 3:80103447-80103469 ATGTTTTTAAAGGAGAAGGTAGG - Intergenic
959882230 3:111456925-111456947 ATGTCCCTATAGGAAAGGGTTGG - Intronic
960084952 3:113580728-113580750 AATGCTCTATAGTAGAAGGTTGG - Intronic
961726881 3:128936751-128936773 ATGTCTGAAAAACAGAAGGTTGG - Intronic
962409003 3:135125100-135125122 ACCTCTCAATAGCAGAAGCTTGG - Intronic
963194004 3:142506221-142506243 ATGTATCTAAAGGAGAAGGTAGG + Intronic
966483579 3:180441808-180441830 TTGTCTCAATAACACAAGGTTGG + Intergenic
966698807 3:182822030-182822052 ATGGTTCTAAAGCAGAAAGTAGG + Intronic
967083641 3:186073723-186073745 ATGTATCTAAAGCAGAACTTGGG + Intronic
968190525 3:196663970-196663992 AGGTGTCTATGGCAGAAGATAGG + Intronic
969942731 4:10750797-10750819 CTGTCTCAATAGCATGAGGTGGG + Intergenic
970105002 4:12572223-12572245 ATGTGCCCATAGCAGAAGCTAGG - Intergenic
971534031 4:27725912-27725934 TTGTTTCTATAGGAAAAGGTTGG + Intergenic
971766006 4:30832954-30832976 ATATCTCTGTAGCAGAAAGGTGG + Intronic
973059054 4:45696582-45696604 ATGTAGCTGTAGCAGAATGTGGG - Intergenic
973080421 4:45984569-45984591 ATTTCTCTGTAGGAAAAGGTTGG - Intergenic
973327143 4:48874634-48874656 ATCTCTCTAATGCTGAAGGTAGG + Intergenic
978816920 4:112917183-112917205 TTGTCACTTTAGCAGAAAGTTGG - Intronic
980481369 4:133391638-133391660 ATGTGTCTATAGCAGAGCCTAGG - Intergenic
981957093 4:150490792-150490814 AGGTCACTAGAACAGAAGGTGGG + Intronic
983639971 4:169936079-169936101 ATGTGACTATATCAGAAGCTAGG - Intergenic
986458905 5:7949206-7949228 AAGTATCTTTAACAGAAGGTGGG + Intergenic
987234039 5:15925237-15925259 ATGTCTGTATAACAAAGGGTGGG + Intronic
990819130 5:59817585-59817607 ATGTCACTATATCTGAAGATAGG + Intronic
991965179 5:72083614-72083636 CAGTCTTTATAGCAGTAGGTTGG + Intergenic
994487990 5:100403153-100403175 CTGTCTATATAGCAGTAAGTGGG + Intergenic
997887217 5:137640739-137640761 CTGTCTCTAGAGCAGGAGTTGGG - Intronic
997938572 5:138135893-138135915 TTGTCTCTATCACAAAAGGTTGG + Intronic
1002802793 6:542108-542130 AGTTCTCTATAGGAGAAGGTGGG + Intronic
1003212562 6:4080013-4080035 TTTTCTCTATATCAAAAGGTGGG - Intronic
1008796180 6:55305677-55305699 ATATCTCTAAAGCAAAAGCTGGG + Intergenic
1010131909 6:72504109-72504131 ATGTCTCTGTAGGTGGAGGTAGG - Intergenic
1014597626 6:123364690-123364712 ATGTCCAAATAGCAGAAGATAGG - Intronic
1016591107 6:145744226-145744248 ATTTCTCTATGTGAGAAGGTTGG + Intergenic
1016721067 6:147298400-147298422 ATGTGTCTATTGCTGAAAGTAGG - Intronic
1017560201 6:155619118-155619140 ATCACTCTATAGCAGCAGATAGG + Intergenic
1020893847 7:13914791-13914813 CTGCCTCTATAGCAGAATGGAGG + Intronic
1027721082 7:81742343-81742365 ATTTCACTATAGCAGAATGATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028656645 7:93216077-93216099 ATGTCCCAATAGCAGCTGGTTGG + Intronic
1029330469 7:99849479-99849501 CTGTGTGTATAGCAGAAGGAAGG + Intronic
1029789797 7:102830284-102830306 GTGGCTCTAAAGCAGAAAGTAGG - Intronic
1030355473 7:108537817-108537839 ATGACTTTATAGCCGCAGGTTGG + Intronic
1032675533 7:134126982-134127004 ATGTCTCTAAAGCAGTCTGTAGG - Intergenic
1033673489 7:143515017-143515039 ATTTCTCTTCTGCAGAAGGTGGG - Intergenic
1037429074 8:18790600-18790622 ATGTTTTTATAGAAGAATGTTGG - Intronic
1039208940 8:35189203-35189225 GAGCCTCTATAGGAGAAGGTGGG - Intergenic
1039615236 8:38950376-38950398 AGGTCTCTAGAGGAGAAGGCAGG - Intronic
1040396327 8:47003889-47003911 ATGTCCAAAAAGCAGAAGGTTGG - Intergenic
1041567456 8:59295857-59295879 ATGTCTCAATTACAGAATGTGGG + Intergenic
1041981274 8:63863910-63863932 ATGTGCCAATAGCAGAATGTGGG - Intergenic
1044130413 8:88516701-88516723 ATGTATTTCTAGCAGAATGTTGG + Intergenic
1044233600 8:89806332-89806354 ATCTCTCTACAGCACAAGCTGGG + Intergenic
1046688896 8:117260199-117260221 CAGTCTCTATAGTGGAAGGTTGG - Intergenic
1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG + Intronic
1047984318 8:130216731-130216753 ATGTCTGTATTACAGAGGGTGGG - Intronic
1048112550 8:131484562-131484584 ATGTCTGTATTTCAGAAGGAGGG + Intergenic
1050243559 9:3662954-3662976 ATGTCTCAATTCCAGAAGGTGGG + Intergenic
1050334907 9:4581512-4581534 ATGTCTCTATAGCCTGAGGCTGG - Intronic
1053105976 9:35408226-35408248 ATGTCTGTATAGCAAATCGTGGG + Intergenic
1055455599 9:76468669-76468691 ATCTCTCTTTAGCAGAAAGATGG + Intronic
1057411756 9:94822709-94822731 ATGTCTCCATAGCTGATGATAGG + Intronic
1058506102 9:105667593-105667615 AGTTATCTATAACAGAAGGTAGG - Intergenic
1061312204 9:129771131-129771153 AGGTCTCTTTAGGGGAAGGTTGG + Intergenic
1061417328 9:130454205-130454227 CTGTCTCTGTAGCAGGGGGTGGG + Intronic
1061728177 9:132592845-132592867 ATGTCTCTATATCATAAGCCTGG - Intergenic
1190282424 X:48939837-48939859 ATGTCTCTAAAGCAAATGGTAGG - Intronic
1190282618 X:48940930-48940952 AAGTCTCTAAAGCAAATGGTAGG + Intronic
1200173241 X:154094544-154094566 ATGTCACCATAGCAGAGGGCAGG + Intronic
1201254180 Y:12090956-12090978 GTTTCTCTATAGCTGGAGGTGGG - Intergenic
1201413965 Y:13729275-13729297 CTCTCTCTATAGAGGAAGGTTGG - Intergenic