ID: 1146205466

View in Genome Browser
Species Human (GRCh38)
Location 17:30901403-30901425
Sequence TTCAAACTCAAGTGTAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146205461_1146205466 14 Left 1146205461 17:30901366-30901388 CCTATACTCATTCTCAGCACCTT 0: 1
1: 0
2: 2
3: 18
4: 249
Right 1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 129
1146205463_1146205466 -5 Left 1146205463 17:30901385-30901407 CCTTGCCCAAAGTAGGCATTCAA 0: 1
1: 1
2: 11
3: 150
4: 985
Right 1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 129
1146205464_1146205466 -10 Left 1146205464 17:30901390-30901412 CCCAAAGTAGGCATTCAAACTCA 0: 1
1: 0
2: 2
3: 12
4: 155
Right 1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146205466 Original CRISPR TTCAAACTCAAGTGTAGCCA AGG Intronic
907855269 1:58297325-58297347 TTCAAATTCAAGTGTACATAAGG + Intronic
908725314 1:67169768-67169790 TGCAAACTCAAATGTCTCCAGGG + Intronic
909041433 1:70657387-70657409 TACAAACTCAAGTTTTCCCAGGG - Intergenic
916080624 1:161229737-161229759 TTCCCACTCCAGTGTATCCAGGG + Exonic
918856901 1:189767433-189767455 ATGAATGTCAAGTGTAGCCATGG + Intergenic
922408603 1:225345272-225345294 TTCAAACTAAAATGTGTCCAAGG + Intronic
922628851 1:227083256-227083278 TTTAGACTAAAGTGTAGTCAGGG - Intronic
1062963291 10:1589592-1589614 TTCTAACTCAGGGGTGGCCATGG - Intronic
1063777920 10:9285063-9285085 TTCAAAATTAAGTGTGGCGAGGG - Intergenic
1063918027 10:10904086-10904108 TCCAGACTCAAATGTACCCATGG + Intergenic
1064862820 10:19846140-19846162 TGGTAACTCAAGTGTAGTCATGG + Intronic
1067271022 10:44791370-44791392 TTTAAACTAAAATGTAGCCGGGG - Intergenic
1069750364 10:70741447-70741469 TTCACACACAGGTGTTGCCAAGG + Intronic
1069933095 10:71896754-71896776 TTTAAATTTAAGTGTAGCTAAGG + Intergenic
1071286892 10:84157099-84157121 TTTTATCTCGAGTGTAGCCACGG - Intergenic
1079280767 11:19085085-19085107 TTCAAACTCCTGTGTTTCCAAGG + Intergenic
1079697866 11:23506228-23506250 TTAAAACTAAAGTGTAGAAATGG - Intergenic
1088461539 11:110088663-110088685 TGCAACACCAAGTGTAGCCATGG + Intergenic
1093521293 12:20053135-20053157 TTCAAACTGCAGTTTAGTCATGG + Intergenic
1095852245 12:46823598-46823620 GTTAAACTCAAGTCTAGTCAGGG + Intronic
1097582726 12:61478590-61478612 TTCATAGTCAAGTGTAGTCTTGG + Intergenic
1097837069 12:64283804-64283826 TTCAAACACAAGGTGAGCCAGGG - Intronic
1098415403 12:70229369-70229391 TTAAAACTTAAGTAAAGCCAGGG - Intergenic
1099003351 12:77207239-77207261 CTCAAGCTAAAGTGTTGCCAAGG + Intergenic
1101260535 12:103025129-103025151 TGCAAACACAACTGTATCCAGGG - Intergenic
1101829077 12:108243087-108243109 CTCAAACTCAAGTGTCTCCAGGG - Intronic
1104266772 12:127240767-127240789 TTCAAACTCAAATGCACACAGGG + Intergenic
1107332122 13:39312258-39312280 TTAGAACTAAGGTGTAGCCAAGG + Intergenic
1108967620 13:56329940-56329962 TGCAATCTCAACTGTAGGCAGGG - Intergenic
1110564373 13:76943220-76943242 ATAAAACTCAAGTGGAGACAAGG + Intergenic
1110959816 13:81607484-81607506 TTCAATCTCAAGTATAGCAAGGG - Intergenic
1113301532 13:109027069-109027091 TTCAAAGTCAAGTGTTGGCAGGG + Intronic
1117615615 14:57531038-57531060 ATCAAAATCAGATGTAGCCAGGG - Intergenic
1121098232 14:91232919-91232941 GTCAAAGCCAAGTGTAGCCCTGG + Exonic
1123798917 15:23801611-23801633 CTCAGACTCAGATGTAGCCAGGG - Intergenic
1126172538 15:45706348-45706370 TTCAATCCTAAGTGTAACCAGGG - Intergenic
1126834181 15:52642846-52642868 ATCAAACTAAACTGTAGCCTGGG - Intronic
1127299019 15:57634429-57634451 TGCAAACTCATATGCAGCCAGGG - Intronic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1128566892 15:68706652-68706674 TTCCTACTCAAGTGCAGACAAGG + Intronic
1131329823 15:91486698-91486720 TTCAAAATCAAGTTTAACTATGG - Intergenic
1133841416 16:9413178-9413200 TTAAAATTCAGGTCTAGCCAAGG + Intergenic
1134996951 16:18746798-18746820 TTGAAACCCATGTGTAGCCTGGG + Intergenic
1137949672 16:52771625-52771647 TTCAAACTCAGGTTTAGCTGAGG + Intergenic
1139580475 16:67870661-67870683 CTCAAATCCCAGTGTAGCCAAGG - Intronic
1140304519 16:73790627-73790649 TTGGAACTCAAGTGTACTCAAGG - Intergenic
1140918528 16:79515701-79515723 TTCATGCCCAAGTGTAGCAAGGG - Intergenic
1142943021 17:3398859-3398881 TTAAAACTCAGGTGTAGGCTGGG + Intergenic
1143881646 17:10034677-10034699 GTCACATTCAAGTGTAGACATGG + Intronic
1144393616 17:14820662-14820684 TTCAAACCAAAGTGAAGCCCAGG - Intergenic
1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG + Intronic
1146658022 17:34646451-34646473 TCCAGACTCTAGTGTACCCATGG + Intergenic
1149696108 17:58617307-58617329 TCTAAACTCAAGTGTAGCCCAGG + Intronic
1150897109 17:69224845-69224867 TTCAAACTCAAGCTTAGCAATGG - Intronic
1151390665 17:73784793-73784815 TTGCTACTCAAGTGTAGCCTGGG - Intergenic
1158922543 18:62209518-62209540 TTCAAACTTAAGAGTAATCAAGG - Intronic
1160370451 18:78368594-78368616 TTAAAACTCAAATCTACCCACGG + Intergenic
1163305958 19:16479050-16479072 TTCAAACTCAAATGTCTACATGG - Exonic
926820765 2:16849165-16849187 TACAATCTCAAGGGTAGACACGG - Intergenic
929647689 2:43645239-43645261 TTTAAACTCAATTCTAGCCCAGG - Intronic
930244583 2:48970011-48970033 TTCTTACTCAAGTATATCCAAGG - Intronic
930514232 2:52385796-52385818 TTCAAACTTCAGTGTAGAAAGGG - Intergenic
932760252 2:74434955-74434977 CTCAGACTCAAGTGATGCCAGGG + Intronic
933229669 2:79791815-79791837 TTCAAACCCATGTGCAGCAAGGG + Intronic
933652236 2:84858805-84858827 TTCAAACTCCAGTGGAACCATGG + Intronic
935854271 2:107257827-107257849 CTTTAACTCAAGTGTAGCCACGG - Intergenic
938207275 2:129434660-129434682 TTAAAACTCAAGAGTAACCATGG - Intergenic
939494875 2:142916072-142916094 TCCAAAATCAAGTGTTGACAAGG - Intronic
939619485 2:144400603-144400625 TTTAAAGGCAAGTGTAGCCATGG + Intronic
940767751 2:157808327-157808349 TCCACACCAAAGTGTAGCCAAGG - Intronic
941525800 2:166605226-166605248 TTCAATCCCAGGTGTTGCCATGG - Intergenic
942440167 2:176025623-176025645 CTCAAACTCAAATTAAGCCAAGG + Intergenic
942678898 2:178456177-178456199 TACTAACTAAAGTGTTGCCATGG + Intronic
943645708 2:190406850-190406872 CTAAAACTCAAGTGGAGCAAAGG + Intergenic
943737051 2:191367480-191367502 CTCAAACTCAAATGTTTCCAGGG - Intronic
944440394 2:199737392-199737414 TTCAAATTCAAAAGTATCCAAGG - Intergenic
945726332 2:213475513-213475535 TTCAAATTCAAGATTAGCAAGGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1173952847 20:47006877-47006899 TGCAAACTCAAGTGTCTTCATGG - Intronic
1177931656 21:27293033-27293055 TACAACCTCAAATGTAGCCAAGG + Intergenic
1185395705 22:50586576-50586598 TTCAAGCACAGGGGTAGCCAGGG - Intronic
952291322 3:32019062-32019084 TTCAAAATCAAGAGTAGCTTAGG - Intronic
955543732 3:60005169-60005191 TTCAAACTCAAAGGCAGCTAAGG - Intronic
957862606 3:85974587-85974609 ATCATATTCAAGTTTAGCCATGG + Intronic
961546633 3:127638880-127638902 TACAAACTGAAGTGAAGACAGGG - Intronic
962130333 3:132666437-132666459 TTCAAAATCAAGAGTAGGAAAGG - Intronic
967230908 3:187336607-187336629 ATCAAACTCAAGTGTCATCAAGG + Intergenic
968246273 3:197152479-197152501 TTAAAACTCAAGTTTAGGCCGGG + Intronic
969234538 4:5856337-5856359 TTCAGACTCAAGTGTTCCAATGG + Intronic
970436457 4:16040284-16040306 TTCAAACTGATATGTACCCAGGG + Intronic
971160935 4:24133340-24133362 TTCAAATGCAAGTCTAGTCATGG + Intergenic
974777162 4:66499713-66499735 TTCAAACTCACCGGTAGACATGG - Intergenic
976188428 4:82466369-82466391 TTCAACCTCACGAGTAGCTAGGG + Intergenic
976591871 4:86857475-86857497 TCAAAACTCAGGTGTACCCAGGG - Intergenic
976694757 4:87907670-87907692 TCCAAACTCAAGAGTCGGCAGGG + Intergenic
978204683 4:106067162-106067184 TTCACACCCAAGTGTTGGCAAGG - Intronic
978597906 4:110398880-110398902 TTCAAACTCAAATGCTTCCAGGG + Intronic
980948212 4:139345088-139345110 TTCAACCTCAAGGTGAGCCAAGG - Intronic
983307709 4:166014334-166014356 TTCAAACTCAAGTCAATCAAAGG - Intronic
985179011 4:187236394-187236416 TAAATACTCAAGTGTATCCATGG + Intergenic
989811312 5:45679592-45679614 TTCTAACTCAGGTGAAGTCATGG + Intronic
990215725 5:53529912-53529934 TTCAAAATCAACTGTATTCATGG - Intergenic
992902886 5:81316704-81316726 AACAAAATCAAGTGTTGCCAAGG - Intergenic
995983334 5:118135615-118135637 TTCAAAGTGAAGGGTGGCCAAGG + Intergenic
1002430118 5:179198536-179198558 CTCAAACTCCAGTGTAGGCCGGG + Intronic
1007383734 6:41506607-41506629 TTAAAACTCAAGTGAAGCTTGGG - Intergenic
1007728767 6:43933100-43933122 TTCAGACCCAAGGGTGGCCATGG - Intergenic
1011520486 6:88198957-88198979 TTCAAAATCAATGGTTGCCAAGG - Intergenic
1013801989 6:113957173-113957195 TTCAAGATCAAGATTAGCCATGG - Intronic
1014543157 6:122700438-122700460 TTCAAACTCAACTTAAGCCCAGG - Intronic
1017256379 6:152338324-152338346 TTTAAACTCAAGTGTGGGCCAGG + Intronic
1021233489 7:18114307-18114329 CCCAAACTCTATTGTAGCCAAGG - Intronic
1024399850 7:48911712-48911734 TTCAAACTCCCCTGAAGCCAGGG - Intergenic
1025783125 7:64619441-64619463 TTCAAACTAAAATTTAGCTATGG - Intergenic
1026518952 7:71098455-71098477 TTCAAACTCAGCTTCAGCCAGGG - Intergenic
1034382938 7:150714800-150714822 CTGAGACTCAAGTGTAGTCAGGG + Intergenic
1039052635 8:33508844-33508866 TTGAAACTCAACTGTAGGCCGGG + Intronic
1039837045 8:41264972-41264994 TCCAAACCCCAGGGTAGCCATGG - Exonic
1043108468 8:76147069-76147091 TTCAAACTTAAAAGTGGCCAAGG - Intergenic
1043497159 8:80814405-80814427 CTAAAACTCAAGTATAGTCATGG - Intronic
1044243028 8:89908892-89908914 TTCAGCCTCCAGAGTAGCCAGGG - Intronic
1047437628 8:124847879-124847901 GTCAAACTCAAGTGGCGTCAGGG - Intergenic
1047700384 8:127443557-127443579 TTTGAACTCAATTGTTGCCATGG + Intergenic
1047792968 8:128223867-128223889 TTCAAACCCAATTGCAGGCAGGG - Intergenic
1047918840 8:129611987-129612009 AGCAAACTGAAGTTTAGCCAAGG + Intergenic
1048246213 8:132804098-132804120 TTCAAAATCAAAGGAAGCCAAGG - Intronic
1049994451 9:1021364-1021386 TACAAACTCCAGTGCAGGCAAGG + Intergenic
1050724912 9:8638203-8638225 TTCAAAATCAATTTTAGCTATGG - Intronic
1052012876 9:23431804-23431826 TTCAGACTCAAGTGGAGACTTGG + Intergenic
1053372236 9:37572146-37572168 CTCAACCTCAAGAGTAACCAAGG + Intronic
1054730203 9:68694312-68694334 TTCAAAATCCAGTGTTGACAAGG - Intergenic
1186082031 X:5943545-5943567 TGCAACCTCAAGTTTATCCAGGG - Intronic
1186124170 X:6394929-6394951 CTGAAACTCTAGTGTGGCCAGGG + Intergenic
1188586899 X:31787512-31787534 TTGAAACTCAAATATACCCAAGG - Intronic
1191681718 X:63847557-63847579 TTCTAACTCAAATCTAACCAAGG + Intergenic
1192382821 X:70635943-70635965 TCCACACTCCAGTGGAGCCACGG + Intronic
1193378055 X:80785058-80785080 TTCAAATTCTAGTGTAACTATGG + Intronic
1196257212 X:113534742-113534764 TTCTAACTGAAGAGTATCCATGG - Intergenic
1196356505 X:114800506-114800528 ATCAATCTGAAGTGTGGCCAAGG - Intronic
1199199999 X:145076033-145076055 TTAAAACTCAACAGTAACCACGG - Intergenic