ID: 1146208023

View in Genome Browser
Species Human (GRCh38)
Location 17:30921828-30921850
Sequence CCCGAGCTCCGCCGACGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146208023_1146208042 30 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208042 17:30921881-30921903 ACAGTCCTGACGGTGCGGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
1146208023_1146208030 -1 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208030 17:30921850-30921872 GGCCGGACTGGACCTGCCGAGGG 0: 1
1: 0
2: 7
3: 8
4: 84
1146208023_1146208038 20 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208038 17:30921871-30921893 GGAGGGGCGGACAGTCCTGACGG 0: 1
1: 0
2: 0
3: 13
4: 181
1146208023_1146208040 26 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208040 17:30921877-30921899 GCGGACAGTCCTGACGGTGCGGG 0: 1
1: 0
2: 1
3: 1
4: 43
1146208023_1146208032 2 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208032 17:30921853-30921875 CGGACTGGACCTGCCGAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 120
1146208023_1146208041 27 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208041 17:30921878-30921900 CGGACAGTCCTGACGGTGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 31
1146208023_1146208035 7 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208035 17:30921858-30921880 TGGACCTGCCGAGGGAGGGGCGG 0: 1
1: 0
2: 3
3: 55
4: 410
1146208023_1146208029 -2 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208029 17:30921849-30921871 GGGCCGGACTGGACCTGCCGAGG 0: 1
1: 0
2: 7
3: 18
4: 121
1146208023_1146208034 4 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208034 17:30921855-30921877 GACTGGACCTGCCGAGGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 201
1146208023_1146208039 25 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208039 17:30921876-30921898 GGCGGACAGTCCTGACGGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 58
1146208023_1146208033 3 Left 1146208023 17:30921828-30921850 CCCGCGCGTCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1146208033 17:30921854-30921876 GGACTGGACCTGCCGAGGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146208023 Original CRISPR CCCGAGCTCCGCCGACGCGC GGG (reversed) Exonic
900237615 1:1600163-1600185 CCCCGCCTCCGCCGCCGCGCCGG - Intergenic
902044272 1:13513552-13513574 CCCGAGCGCCGCGGCGGCGCAGG + Exonic
905031220 1:34885636-34885658 CTGCAGCTCCGCCGACGGGCTGG - Exonic
912775143 1:112502138-112502160 CCCGGGCTACTCCGGCGCGCAGG + Intronic
915199993 1:154220465-154220487 CCCAGGCTCCGCCGAAGCGACGG + Exonic
916107004 1:161440286-161440308 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916108565 1:161447700-161447722 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916110153 1:161455081-161455103 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916111738 1:161462491-161462513 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916113325 1:161469872-161469894 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
919705332 1:200669991-200670013 GCCGAGCTCCGCCCCCGCGGTGG - Intergenic
923126682 1:231039986-231040008 CCCGGGCCCCGCCGCCGCCCGGG + Exonic
1064086603 10:12350058-12350080 CCCGAGCGCGCCCGACGCGTGGG + Intronic
1069698433 10:70404638-70404660 CCCCAGCTCCACCGAAGCCCCGG + Intronic
1074772592 10:116743094-116743116 CCCGGGCTCGGCCCCCGCGCAGG - Intergenic
1074830150 10:117241897-117241919 CCGGAGCTCCGCCAAGGCCCGGG + Intronic
1076878864 10:133230416-133230438 CCCGAGTTCCCCCAGCGCGCTGG - Exonic
1083660932 11:64251495-64251517 CCCGGGCCCCGCCGAGGCTCTGG + Intergenic
1083962573 11:66022539-66022561 CCCGAGCTTCGCGGAAGGGCCGG - Intronic
1087241824 11:95789538-95789560 CCCGAGAGCCGCCGCCGCCCGGG + Exonic
1090385575 11:126355957-126355979 CCCGCGCTGCGCCCACGTGCAGG - Intronic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1103562570 12:121800216-121800238 CCCGGGATCCCCCGAGGCGCGGG - Intronic
1108688908 13:52845753-52845775 TCCGAGCTCCGCGGACAGGCTGG - Intronic
1113914881 13:113864122-113864144 CCCGCGCCCCGCCCGCGCGCTGG - Intergenic
1115576137 14:34714306-34714328 CCCAACCTGCGCCGACGCCCGGG + Intronic
1116849524 14:49893718-49893740 CCCCGGCTCCTCCGACGCGATGG + Exonic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1119383051 14:74240676-74240698 CCCGAGAGCCTGCGACGCGCTGG - Intronic
1133311068 16:4847273-4847295 CCCAACCACCGCCGACGCACGGG + Exonic
1136399793 16:30011067-30011089 CCCGTCCCCCGCCGCCGCGCCGG - Exonic
1137300587 16:47144211-47144233 CCCGTGCCCAGCCGCCGCGCAGG + Intergenic
1139650584 16:68360150-68360172 CCTGAGCTCAGCCGGCACGCAGG + Exonic
1141620848 16:85235879-85235901 CCCGCGCCCCGCCCCCGCGCTGG + Intergenic
1141641485 16:85344188-85344210 CCCTAGCTCCCCCGCCGGGCAGG - Intergenic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1143492970 17:7294589-7294611 CCCGAGCCTCGCCCACACGCCGG + Intronic
1146208023 17:30921828-30921850 CCCGAGCTCCGCCGACGCGCGGG - Exonic
1150168366 17:62966225-62966247 CGCTAGCGCCGCCGCCGCGCTGG - Intergenic
1152245558 17:79183076-79183098 CCCGCGCTCGGCCGCCGCGCAGG + Intronic
1153872656 18:9334858-9334880 CCCGGGCTCGGCCGACCCGGCGG + Exonic
1155053523 18:22167226-22167248 CCGCAGCTCCGCAGACGCGGCGG - Intergenic
1156338132 18:36187544-36187566 CCCTGACTCCGCCGCCGCGCCGG - Exonic
1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG + Exonic
1163434367 19:17286442-17286464 CCCAAGCGCCGGCGACGAGCAGG - Exonic
925161360 2:1686210-1686232 CCCGAGCCCCGCCCTCGGGCAGG - Intronic
927558040 2:24049763-24049785 CCCCAGCCCCGCCGTCGCTCCGG - Exonic
930411053 2:51027451-51027473 CCCGAGCCCCGCCCAGGCCCCGG + Intronic
943703833 2:191014298-191014320 CCGCTGCTCCGCCCACGCGCTGG + Intronic
945245321 2:207711939-207711961 CCCAAGCTGGGCCGGCGCGCGGG + Exonic
1169213026 20:3778151-3778173 CCAGAGCCCCGACGCCGCGCCGG - Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1178327902 21:31660077-31660099 CCCGCGCTCCCGCCACGCGCAGG - Intronic
1182321525 22:29480997-29481019 CCAGGGCTCCGGCGCCGCGCAGG + Exonic
1183702170 22:39457112-39457134 GCCGGGCTCCGCCGCCGCGCCGG - Intergenic
956420324 3:69080304-69080326 CCGGGGCTCTGCAGACGCGCCGG - Intronic
956678109 3:71753956-71753978 CCCGAGCTCCGCCGCTCCGCCGG - Intronic
961654348 3:128433093-128433115 CCCGAGCTCCGCCCGCCCGCAGG - Intergenic
962804213 3:138915602-138915624 CCCGCGCTCCGCAGGCGAGCTGG + Intergenic
968506426 4:973305-973327 CCCGGGCCCCGCTGCCGCGCCGG - Exonic
969912126 4:10456956-10456978 CGCGGACTCGGCCGACGCGCCGG - Intronic
975342569 4:73258561-73258583 GCCGACCTCCGCCGCCGCGGGGG + Exonic
981300937 4:143185181-143185203 CCCGTACTCCGCCGCCGCCCCGG - Exonic
985462602 4:190121391-190121413 CCCCCGCTCCGGCGCCGCGCCGG + Intergenic
987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG + Exonic
987373973 5:17217683-17217705 TCCGGGCTCCGCCGTCGAGCCGG + Exonic
992690608 5:79236954-79236976 GCCGAGCTCCGCCGGGGCCCGGG - Exonic
993898771 5:93570755-93570777 CCCGGGCCCCTCCGCCGCGCGGG + Intergenic
997305142 5:132830887-132830909 CCCGAGCATCACGGACGCGCTGG - Exonic
1002700717 5:181122523-181122545 CCCGAGCTCAGCAGAGGCCCTGG - Intergenic
1006351063 6:33521597-33521619 CCCGAGCCCCTCCCACGCGATGG - Intergenic
1013225767 6:108118551-108118573 CCCGGGTTCAGCCGCCGCGCCGG - Intronic
1026523058 7:71132741-71132763 CTCGGGCTCCGGCGAGGCGCGGG - Exonic
1027421173 7:78019538-78019560 TCCGAGCTCTGCCGGCGCGAAGG - Exonic
1029493072 7:100882785-100882807 TCCGAGCTCCGTCGATGAGCGGG - Intronic
1040928833 8:52713946-52713968 CCTGAGCCCGGCCCACGCGCAGG - Intronic
1041919825 8:63168943-63168965 CCGGAGCTCCACCCTCGCGCGGG + Intronic
1042785032 8:72537173-72537195 CCCGCGCTCCGCGCACCCGCGGG - Intergenic
1049237257 8:141518556-141518578 CCTGAGCTGCGCCCGCGCGCGGG + Exonic
1060842607 9:126805385-126805407 GCGGAGCTCCGCCGCCGCGAGGG - Intronic
1062542744 9:137048785-137048807 CCTGATCCCCGCCGACCCGCCGG - Exonic
1191878591 X:65822185-65822207 CCCAAGCTGGGCCGGCGCGCCGG - Intergenic
1200093558 X:153647063-153647085 CCCCAGCTCAGCCGACTCGCAGG + Intronic
1200124006 X:153804735-153804757 CCCGAGCTCCACCAACACCCCGG - Exonic
1201240776 Y:11954975-11954997 CCCGAGCGGCGACGACTCGCGGG + Intergenic