ID: 1146208308

View in Genome Browser
Species Human (GRCh38)
Location 17:30922774-30922796
Sequence GGTCGCCGCGCAGCGGCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146208302_1146208308 -7 Left 1146208302 17:30922758-30922780 CCAGGATCTTCACCCCGGTCGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1146208299_1146208308 5 Left 1146208299 17:30922746-30922768 CCTGAACTGCCTCCAGGATCTTC 0: 1
1: 0
2: 4
3: 16
4: 182
Right 1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1146208296_1146208308 11 Left 1146208296 17:30922740-30922762 CCGGGCCCTGAACTGCCTCCAGG 0: 1
1: 1
2: 3
3: 67
4: 469
Right 1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1146208294_1146208308 13 Left 1146208294 17:30922738-30922760 CCCCGGGCCCTGAACTGCCTCCA 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1146208301_1146208308 -4 Left 1146208301 17:30922755-30922777 CCTCCAGGATCTTCACCCCGGTC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1146208293_1146208308 26 Left 1146208293 17:30922725-30922747 CCTCAGACTCTCTCCCCGGGCCC 0: 1
1: 0
2: 3
3: 28
4: 362
Right 1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1146208298_1146208308 6 Left 1146208298 17:30922745-30922767 CCCTGAACTGCCTCCAGGATCTT 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 142
1146208295_1146208308 12 Left 1146208295 17:30922739-30922761 CCCGGGCCCTGAACTGCCTCCAG 0: 1
1: 0
2: 3
3: 41
4: 377
Right 1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146208308 Original CRISPR GGTCGCCGCGCAGCGGCCGG TGG Intronic
900244011 1:1629466-1629488 GGGCGCCGCGCCGGGGCCCGAGG + Exonic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
904037921 1:27568694-27568716 GGCACCCGCGCCGCGGCCGGGGG - Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
907160969 1:52368631-52368653 GGTCCCCGAGCCGCGGCGGGGGG - Intergenic
912401559 1:109397750-109397772 GGCAGCGGCGCAGCGGGCGGCGG + Exonic
912878959 1:113390410-113390432 GGGCGCCGCGCGGCGGGAGGGGG + Intergenic
913186282 1:116373263-116373285 GGGCGCAGAGCAGCGGCGGGAGG + Intronic
915359486 1:155277593-155277615 GGAGGCAGAGCAGCGGCCGGCGG + Exonic
924052677 1:240093225-240093247 GGACGCCCCGCAGAGGCTGGGGG + Exonic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1069544504 10:69318854-69318876 AGCCGCCGAGCAGCCGCCGGAGG + Intronic
1076183205 10:128426764-128426786 GGCCTCCACGCAGCGGCCAGAGG + Intergenic
1076887585 10:133269684-133269706 GGTCACCGGGCAGCGGGCAGGGG - Intronic
1077090746 11:777258-777280 GGGCGCCGGGCAGGGGCCGGGGG - Intronic
1078561733 11:12378071-12378093 GGGCGCCGCTTGGCGGCCGGAGG + Intronic
1079297068 11:19242706-19242728 GGTCGCAGCGCAGCAGCTGCCGG + Intergenic
1080749488 11:35139231-35139253 GGGCGCGGGGCAGGGGCCGGCGG - Exonic
1081831506 11:46119967-46119989 GGGCGCCCCGCGGCCGCCGGCGG + Intronic
1083722030 11:64607923-64607945 GGGCGGCGCGCGGCGGGCGGGGG + Exonic
1083920795 11:65780694-65780716 AGACGCCGCGCAGATGCCGGCGG + Exonic
1084086444 11:66857306-66857328 GGCCCCCGCGCTGCGCCCGGCGG - Intronic
1084204385 11:67583615-67583637 AGTCGCCGCGCAGCTGGCCGGGG - Exonic
1084295683 11:68212652-68212674 GGTCGCCGGGCCACGGCCAGGGG + Intronic
1094051673 12:26226998-26227020 CGGCGCTGCGCAGCGGGCGGAGG - Intronic
1094293828 12:28881409-28881431 GGGGGCAGCGCAGGGGCCGGGGG - Intergenic
1094837907 12:34330806-34330828 GGTCTCCGCGCAGGGGCTGCTGG + Intergenic
1095998004 12:48105826-48105848 GGTGGCCGCGCTGTGGCCGCCGG - Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1106833547 13:33610806-33610828 GTTCTCCGCGCAGTGGCCCGCGG - Intergenic
1111672761 13:91348990-91349012 GGCAGCCGCGCGGCGACCGGCGG - Intergenic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122461952 14:101903371-101903393 GGTGGCCGCGCAGCTGCCAGTGG + Intronic
1122969944 14:105148450-105148472 GGACGCCGGTCAGCGGGCGGGGG + Intronic
1123500812 15:20878822-20878844 GGCCGGCGCGCAGGGGCAGGTGG - Intergenic
1123558063 15:21452517-21452539 GGCCGGCGCGCAGGGGCAGGTGG - Intergenic
1123594291 15:21889798-21889820 GGCCGGCGCGCAGGGGCAGGTGG - Intergenic
1123710202 15:22980838-22980860 GGTCGGCGCGCAGAGCCCGCTGG + Intronic
1125429488 15:39581002-39581024 GGCCGCCGCCCATTGGCCGGAGG + Intergenic
1128160933 15:65422620-65422642 GGTCTGCGAGCTGCGGCCGGGGG - Intronic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131238411 15:90717228-90717250 GGTCGCCGTACAGCGCCGGGAGG - Intergenic
1132314281 15:100879344-100879366 GGGCGCGGCGCAGGGCCCGGCGG + Intronic
1202966413 15_KI270727v1_random:179689-179711 GGCCGGCGCGCAGGGGCAGGTGG - Intergenic
1132579067 16:676903-676925 GCTCCCGGGGCAGCGGCCGGGGG - Intronic
1134531928 16:14990028-14990050 GTCCGGCGCGCAGCGGGCGGCGG - Intronic
1135296515 16:21283860-21283882 GCCCGCCGCGCAGCCGCCCGCGG - Intronic
1138229893 16:55329131-55329153 AGTCGCCGGGCAGAGGCAGGAGG - Exonic
1141054530 16:80803721-80803743 GGGGGGCGCGCCGCGGCCGGCGG - Intronic
1141683030 16:85555128-85555150 GGTAGGGGCGCAGCGGCGGGCGG - Intergenic
1142833834 17:2569780-2569802 GGTGGACAGGCAGCGGCCGGAGG + Intergenic
1143510549 17:7393230-7393252 GGCGGACACGCAGCGGCCGGCGG + Exonic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1147508739 17:41047072-41047094 GGTCGCAGCACACCGGGCGGCGG + Exonic
1147509478 17:41055016-41055038 GGTCGCAGCACACCGGGCGGCGG + Exonic
1147509986 17:41059855-41059877 GGTCGCAGCACACCGGGCGGCGG + Exonic
1147510579 17:41065650-41065672 GGTCGCAGCACACCGGGCGGCGG + Exonic
1152069816 17:78128863-78128885 AGTCGCCGCGGGGCGCCCGGAGG - Intronic
1154231107 18:12557179-12557201 GGTCGCCGCGGAGCAGGGGGTGG + Intronic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1156463482 18:37334542-37334564 GGTCTCCGTCCAGCCGCCGGTGG - Intronic
1160256130 18:77250237-77250259 CGTGGTCGCGCAGCGGGCGGAGG + Intergenic
1161157409 19:2739883-2739905 GGGCGGCGCTGAGCGGCCGGGGG - Intronic
1161293530 19:3507899-3507921 AGGCGCCGGGCAGCGGCCAGTGG - Intronic
1161580272 19:5077096-5077118 GGTCACTGCGCAGAGGCCAGAGG + Intronic
1162758286 19:12873518-12873540 GGTCCCCGCGCAGGTGCAGGAGG - Intronic
1162799449 19:13102813-13102835 CCTGGCGGCGCAGCGGCCGGAGG + Exonic
1163033694 19:14560125-14560147 GGACGCCGGGCTGCGGCAGGAGG - Intronic
1163138647 19:15331960-15331982 GGGCGCCGCGGCGGGGCCGGCGG - Intronic
1163167617 19:15508684-15508706 GGTCTGCGCGCGGCGGCGGGCGG + Intronic
1163334333 19:16661141-16661163 AGTCGCCGGGCCGCGGGCGGCGG + Exonic
1164617222 19:29674472-29674494 GGCCGCCCAGCAGCGGCAGGAGG + Exonic
1165313523 19:35041772-35041794 GGTGGCCCCGCAGCAGCGGGCGG - Exonic
1166343150 19:42150577-42150599 GGGCTCAGCGCAGAGGCCGGCGG + Intronic
1167456177 19:49597569-49597591 GGTCGCGGCGCCGCAGCAGGTGG - Exonic
927690410 2:25204307-25204329 GAGCGCCGCGCAGAGGCCCGAGG - Intergenic
927988350 2:27429061-27429083 GGTCGCGGCCCGGCGGCCTGCGG + Intronic
932036443 2:68251892-68251914 GGGCGCCCCGCAGAGGCCGGGGG + Intronic
935137651 2:100321814-100321836 GCTCGGGGCGCTGCGGCCGGAGG - Exonic
936433287 2:112482302-112482324 GGCCGCCGGGCAGCCGCCGCAGG - Exonic
942346206 2:175005224-175005246 GGCCGCGGCGCAGTGGCTGGCGG + Exonic
945404018 2:209423833-209423855 GGTCCCCGCCTGGCGGCCGGCGG + Intergenic
947506584 2:230712766-230712788 GGGCGCCCCCGAGCGGCCGGCGG - Intergenic
947641660 2:231710533-231710555 GCTCGCCGGACAGCGGCCGAGGG + Intronic
1170150510 20:13221732-13221754 GGACCCGGCGCGGCGGCCGGCGG - Intergenic
1170821564 20:19758956-19758978 GATGGCTGCGCAGCGGGCGGAGG + Intergenic
1171175577 20:23049180-23049202 GGAAGCCGCGCAGGGGCCCGAGG + Exonic
1172039060 20:32031155-32031177 TGGCGCGGCGCAGCGGCCCGAGG + Exonic
1174353201 20:49982597-49982619 GGCCGGCGCGCAGCGCCAGGGGG + Intergenic
1176202108 20:63865744-63865766 GGGCCCCGCGCAGGGACCGGGGG - Intronic
1176448173 21:6840082-6840104 GCTCGAGGCGCTGCGGCCGGAGG + Intergenic
1176826343 21:13705104-13705126 GCTCGAGGCGCTGCGGCCGGAGG + Intergenic
1179971486 21:44838442-44838464 GGTCGCTGAGCAGGGGCCTGGGG + Intergenic
1181831669 22:25564954-25564976 GGTCGGGGCGCGGCGGGCGGCGG + Exonic
1182236944 22:28883601-28883623 GGCCGCGGCGCGACGGCCGGGGG + Exonic
1182355236 22:29719895-29719917 GGCGGCCGCTCAGGGGCCGGCGG + Intergenic
1183683768 22:39350208-39350230 CGCCGCCGCGCCGCCGCCGGGGG - Intronic
1184155252 22:42662726-42662748 GGGCGCCGCCCAGCGCCCCGTGG - Intergenic
1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG + Intergenic
1184642051 22:45877940-45877962 GGCCGCCGCGCAGCGGGCTGAGG + Intergenic
1185055301 22:48575978-48576000 CGACGCCGAGCAGCGGGCGGTGG + Intronic
1185272346 22:49935233-49935255 GGGCGCCGGGCAGAGGCTGGAGG - Intergenic
952011233 3:28903199-28903221 GGGCGCCGCGGAGCAGCGGGTGG + Intergenic
958732308 3:97972418-97972440 CGTTGCGGCGCAGCGGCTGGAGG + Exonic
960269470 3:115658607-115658629 GCTCTCCGTGCAGCGGGCGGAGG - Intronic
961603393 3:128077042-128077064 GGGCGGCGCGCAGCGGGCGGCGG - Intronic
964786289 3:160399898-160399920 GGCCGCCGGGGAGCGGCCGAGGG - Intronic
967896267 3:194398171-194398193 GGACGCCGCGCAGTGCTCGGGGG - Exonic
970408707 4:15787195-15787217 AGTGGGCGCGCAGAGGCCGGGGG + Intronic
973981992 4:56314996-56315018 GGAAGCCGCGCAGCCTCCGGTGG + Exonic
981475281 4:145180787-145180809 GGTCGCCCCACATCGGCCGGCGG - Intergenic
981617359 4:146655457-146655479 GGCCGCGGCGGAGCGGCCGGCGG - Intergenic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
985445127 4:190017551-190017573 AGGCGCAGCGCGGCGGCCGGCGG + Intergenic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
988734655 5:34008112-34008134 GGGCGCGGCGCCGCGGCTGGGGG - Intronic
996738230 5:126776803-126776825 GGTCCCCGCGGGGCGGCGGGAGG + Intronic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002634774 5:180601861-180601883 AGGCGCCGCGCAGCGGGCAGGGG - Exonic
1004861055 6:19804985-19805007 GGTCGCCCCGCGGCGGCCAGAGG + Intergenic
1007600118 6:43076229-43076251 GGGCGCCGTGCGGGGGCCGGAGG + Intergenic
1007785342 6:44276479-44276501 CGTGGCGGTGCAGCGGCCGGTGG - Exonic
1008545058 6:52576919-52576941 AGCGGGCGCGCAGCGGCCGGCGG + Intergenic
1009940450 6:70282825-70282847 GGTCGGGGCGCAGCGGTCGAGGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1018876641 6:167827269-167827291 GGGCGCGGCGCAGCGGGCGGGGG - Intronic
1020009302 7:4799699-4799721 GGCAGCCCCGCAGCGGCCGACGG - Exonic
1020445416 7:8262273-8262295 CAGCGCAGCGCAGCGGCCGGGGG + Exonic
1022427949 7:30285539-30285561 GGCCGCCGCGGCGCCGCCGGAGG - Exonic
1029461077 7:100694143-100694165 GGGCGGCGCGCGGCGGGCGGGGG + Intergenic
1030983263 7:116210783-116210805 GCGCGGCGCGCGGCGGCCGGAGG + Intronic
1031966590 7:128031782-128031804 GGGGGCCGGGCAGCGGCGGGCGG - Intronic
1034200815 7:149281945-149281967 GGTCGCCGCTCCGTGGCAGGGGG + Exonic
1034344651 7:150379066-150379088 GGTCTCCTCCCCGCGGCCGGCGG + Intronic
1034491555 7:151395740-151395762 GGTCCCCGCCCAGCAGCCAGGGG - Intronic
1036561443 8:9903296-9903318 GACCTCCGCGCAGCGGCCGCGGG - Intergenic
1038484206 8:27922036-27922058 GGGCGCAGTGCAGCGGCTGGAGG - Exonic
1040501376 8:48008333-48008355 GGTCGCCCCGCGCCCGCCGGGGG + Intergenic
1041689819 8:60678431-60678453 GGCAGCAGCGCACCGGCCGGCGG + Intergenic
1057869900 9:98709327-98709349 GGTCGGCGGGCAGCGGCAGCTGG - Intergenic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061004735 9:127922047-127922069 GGGCGTCGGGCAGCAGCCGGCGG + Exonic
1062073653 9:134572671-134572693 GGCCCCCGCTCAGCGGCAGGCGG - Intergenic
1062435806 9:136546117-136546139 GGTGGCCGCGGAGGGGGCGGGGG - Intergenic
1062476256 9:136728824-136728846 GGTCGCCGGGCTGCGAACGGTGG + Intergenic
1062499147 9:136844914-136844936 GGGCGGTGCGCAGCGGCCCGCGG - Exonic
1062517731 9:136944602-136944624 GGGGGCGGCGCAGCGGGCGGAGG - Exonic
1203521018 Un_GL000213v1:44436-44458 GCTCGAGGCGCTGCGGCCGGAGG - Intergenic
1187281396 X:17860829-17860851 CGGCGCCGCGCACTGGCCGGCGG - Intronic
1187547403 X:20267114-20267136 GAGCGGAGCGCAGCGGCCGGGGG - Intergenic
1189337149 X:40176810-40176832 GGTGGCGGCGCAGCTGGCGGGGG - Intronic
1199772570 X:150983975-150983997 GGCCGTCGCGGAGCGCCCGGTGG + Intronic