ID: 1146223623

View in Genome Browser
Species Human (GRCh38)
Location 17:31047952-31047974
Sequence GCTTGATCCTGACCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146223617_1146223623 24 Left 1146223617 17:31047905-31047927 CCAGGTCCAAAGGTTGAACTGTA No data
Right 1146223623 17:31047952-31047974 GCTTGATCCTGACCTGGTGTTGG No data
1146223618_1146223623 18 Left 1146223618 17:31047911-31047933 CCAAAGGTTGAACTGTAATGCTG No data
Right 1146223623 17:31047952-31047974 GCTTGATCCTGACCTGGTGTTGG No data
1146223616_1146223623 25 Left 1146223616 17:31047904-31047926 CCCAGGTCCAAAGGTTGAACTGT No data
Right 1146223623 17:31047952-31047974 GCTTGATCCTGACCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146223623 Original CRISPR GCTTGATCCTGACCTGGTGT TGG Intergenic
No off target data available for this crispr