ID: 1146224204

View in Genome Browser
Species Human (GRCh38)
Location 17:31051697-31051719
Sequence GGGTGGTGATTACAAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146224204_1146224208 1 Left 1146224204 17:31051697-31051719 CCACTTTCTTGTAATCACCACCC No data
Right 1146224208 17:31051721-31051743 CTCTTCCAGTTCCGTCTTTTTGG No data
1146224204_1146224209 2 Left 1146224204 17:31051697-31051719 CCACTTTCTTGTAATCACCACCC No data
Right 1146224209 17:31051722-31051744 TCTTCCAGTTCCGTCTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146224204 Original CRISPR GGGTGGTGATTACAAGAAAG TGG (reversed) Intergenic