ID: 1146226202

View in Genome Browser
Species Human (GRCh38)
Location 17:31068518-31068540
Sequence AGGGGCGCCCTCTACAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146226195_1146226202 1 Left 1146226195 17:31068494-31068516 CCTCGTAAAAGAGCCAGGCAGAA No data
Right 1146226202 17:31068518-31068540 AGGGGCGCCCTCTACAGGATGGG No data
1146226193_1146226202 12 Left 1146226193 17:31068483-31068505 CCATGAGATGTCCTCGTAAAAGA No data
Right 1146226202 17:31068518-31068540 AGGGGCGCCCTCTACAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146226202 Original CRISPR AGGGGCGCCCTCTACAGGAT GGG Intergenic