ID: 1146228388

View in Genome Browser
Species Human (GRCh38)
Location 17:31087714-31087736
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146228383_1146228388 13 Left 1146228383 17:31087678-31087700 CCAGAACTCTGGAGGTAGGCAGT No data
Right 1146228388 17:31087714-31087736 AGCTGCTTGAAGAAGTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146228388 Original CRISPR AGCTGCTTGAAGAAGTATCA GGG Intergenic
No off target data available for this crispr