ID: 1146229348

View in Genome Browser
Species Human (GRCh38)
Location 17:31094856-31094878
Sequence TGCCGCGCATGCGCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146229348 Original CRISPR TGCCGCGCATGCGCCCGCGC CGG (reversed) Intergenic
900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG + Intronic
902350069 1:15847799-15847821 GGCAGCGCATGCGCCCGGGCAGG - Intergenic
903652371 1:24929927-24929949 GGCCGAGGAGGCGCCCGCGCCGG - Intronic
906650361 1:47508458-47508480 TGCCGGGCCTGCGGCCGCGGCGG - Intergenic
915544918 1:156591750-156591772 CGCCGCACATGCGCCGGGGCCGG + Exonic
916483403 1:165235667-165235689 GGCCTCGCCTCCGCCCGCGCGGG + Intronic
1083869372 11:65477501-65477523 TGCCTCCCCTGCCCCCGCGCCGG - Intergenic
1086634168 11:89062879-89062901 TGCCGCTCATGCCCCCGCCGTGG + Intronic
1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG + Intronic
1094839480 12:34336939-34336961 TGCCGCGCATGCGCAGGGTCCGG + Intergenic
1096159818 12:49367284-49367306 TGGCGCGCACGCGCCCGAGAGGG + Intronic
1100142386 12:91634238-91634260 TGGCGCGCAGGCGCCCACGGCGG - Intergenic
1105040293 12:132956061-132956083 TTCCGCGCATGCGCCCAGGCCGG + Intronic
1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG + Intergenic
1122688513 14:103521090-103521112 TGCCGCGCCTCCTCCTGCGCCGG - Intronic
1129752772 15:78077543-78077565 AGCCGCGCTGGCTCCCGCGCCGG + Exonic
1132920316 16:2386196-2386218 TGCGGCTCATGCCCCCGCTCAGG - Intergenic
1136498379 16:30657904-30657926 TGCTGTGCCTGCGCCTGCGCCGG - Intergenic
1140480302 16:75258859-75258881 TGCTGCGCCTGCCCCAGCGCTGG - Intronic
1142264123 16:89055710-89055732 TGCCCTGCATGAGCCCGGGCAGG - Intergenic
1142863397 17:2776773-2776795 TGCCGCGCACGCGCGCACCCCGG - Intergenic
1143172864 17:4940045-4940067 CTGCGCGCCTGCGCCCGCGCCGG - Exonic
1143174614 17:4948983-4949005 GCCCGCGCCTGCGCCTGCGCCGG + Exonic
1146132685 17:30292135-30292157 GGCCGCGCCTGCCCCCGCGCAGG + Intergenic
1146229348 17:31094856-31094878 TGCCGCGCATGCGCCCGCGCCGG - Intergenic
1151362743 17:73598342-73598364 TGCCCTGCATGAGCCCGCACAGG - Intronic
1152809589 17:82375299-82375321 GGCCCCGCACGCGGCCGCGCAGG - Exonic
1152952845 18:11082-11104 CTCCGCGCCTGCGCCTGCGCCGG - Intergenic
1152952853 18:11117-11139 CTCCGCGCCTGCGCCTGCGCCGG - Intergenic
1162799036 19:13101048-13101070 TGCCTCGCCTGGGCCCCCGCAGG - Exonic
1167604903 19:50476444-50476466 TGACGCCCGTGCGCCTGCGCTGG - Exonic
925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG + Intronic
927472637 2:23386702-23386724 CGCCGCGCGGGTGCCCGCGCTGG + Intronic
935137586 2:100321561-100321583 CGCCGCACCTGCGGCCGCGCGGG + Exonic
938496933 2:131802635-131802657 CTCCGCGCCTGCGCCGGCGCTGG + Intergenic
942565828 2:177264370-177264392 CGCCGCGCTTGCGCCGGGGCAGG - Intronic
943941405 2:194002815-194002837 TGCCGCGCAGGAGCCCACGGTGG + Intergenic
948248692 2:236507633-236507655 TTCCGCGCCTGCGCCACCGCGGG + Intergenic
1172640206 20:36436186-36436208 CGCTGCGCATGCGCCGGCACGGG - Exonic
1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG + Exonic
1175913485 20:62415309-62415331 GGCCACGCATGCCCCCGCCCAGG - Intronic
1176159805 20:63642310-63642332 TGCCGCTCACGCGCGCCCGCCGG - Intronic
1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG + Intronic
954025787 3:47781984-47782006 TGCTACGCATGCGCGTGCGCTGG - Intronic
968341577 3:197960191-197960213 TGACGCCTCTGCGCCCGCGCCGG - Intronic
968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG + Intronic
975373934 4:73620458-73620480 CGCCGCCCCTGCGCCCGCGCGGG - Exonic
978777379 4:112516795-112516817 TGCGGTGCCTGCGCGCGCGCCGG - Intergenic
984928328 4:184825872-184825894 AGCCGCGCCTGCTCCCGCGGCGG - Intronic
985704988 5:1395234-1395256 CGCTGCACTTGCGCCCGCGCGGG - Intronic
992627408 5:78648406-78648428 GGCTCCCCATGCGCCCGCGCGGG + Intronic
998134668 5:139668409-139668431 TGCCGCCCCGGCGCCCGCCCGGG + Intronic
1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1005992838 6:30914211-30914233 TGCTGCGCATGCGCCGGCCGGGG + Intronic
1014913575 6:127119821-127119843 TGTCGGGGATGCGGCCGCGCAGG - Intronic
1015935599 6:138404058-138404080 TGCCGCGGCCCCGCCCGCGCTGG - Intronic
1017324579 6:153130965-153130987 CGCCGCGCAGCCGCCCCCGCCGG + Intronic
1018952132 6:168386117-168386139 TGCAGTGCATGTGCCCGCACAGG + Intergenic
1020253004 7:6484192-6484214 TGCCCCGCGCGCGCGCGCGCCGG - Exonic
1032117090 7:129126591-129126613 TGCCTCGGAGGCGCCCTCGCTGG - Intergenic
1036755078 8:11466427-11466449 GGCCGCTCATGCGCTCCCGCGGG - Intronic
1038326760 8:26577729-26577751 GGCGGCGCGAGCGCCCGCGCTGG - Intronic
1038644025 8:29348833-29348855 TTCCGCGCATTCTTCCGCGCGGG - Intronic
1049227840 8:141466230-141466252 TGCCTCCCATGTGCCCGCCCAGG + Intergenic
1052362218 9:27573456-27573478 TGCGGTGCCTGCGCCCGCGGCGG - Intronic
1057601891 9:96465385-96465407 TGCCGCGCATACCCCCTCTCGGG - Exonic
1193743225 X:85243868-85243890 TCTCGCGCACGCGCGCGCGCGGG - Intergenic
1200274176 X:154716281-154716303 TGCCGCTCATGCGGCCTCGCCGG + Exonic