ID: 1146230802

View in Genome Browser
Species Human (GRCh38)
Location 17:31107213-31107235
Sequence TTTTGGGTAATGAGTGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146230794_1146230802 26 Left 1146230794 17:31107164-31107186 CCTTGGGTCTGGGAAAATGTGCC 0: 1
1: 0
2: 1
3: 18
4: 158
Right 1146230802 17:31107213-31107235 TTTTGGGTAATGAGTGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 127
1146230792_1146230802 30 Left 1146230792 17:31107160-31107182 CCCACCTTGGGTCTGGGAAAATG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1146230802 17:31107213-31107235 TTTTGGGTAATGAGTGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 127
1146230796_1146230802 -5 Left 1146230796 17:31107195-31107217 CCATGTGAGTCTTCTTCCTTTTG 0: 1
1: 0
2: 2
3: 37
4: 368
Right 1146230802 17:31107213-31107235 TTTTGGGTAATGAGTGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 127
1146230795_1146230802 5 Left 1146230795 17:31107185-31107207 CCTTTATGCTCCATGTGAGTCTT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1146230802 17:31107213-31107235 TTTTGGGTAATGAGTGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 127
1146230793_1146230802 29 Left 1146230793 17:31107161-31107183 CCACCTTGGGTCTGGGAAAATGT 0: 1
1: 0
2: 4
3: 16
4: 148
Right 1146230802 17:31107213-31107235 TTTTGGGTAATGAGTGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146230802 Original CRISPR TTTTGGGTAATGAGTGCGGA GGG Intronic
903455304 1:23483518-23483540 GTTTGTGGAATGAATGCGGATGG - Intronic
907714657 1:56915836-56915858 ATTTGGGGAATGAGAGCAGAGGG + Intronic
909730097 1:78879156-78879178 TGTTTGGTAATGTGTGCGGCTGG - Intergenic
909886702 1:80950357-80950379 TTTTGTGTAAGGTGTGAGGAAGG - Intergenic
909939706 1:81596851-81596873 TTTTGGGTGATGAGTGGACACGG + Intronic
910642262 1:89475913-89475935 TTTTGGGTAAAGAGTTCTGTAGG - Intergenic
914957469 1:152176244-152176266 TTTTGGGTGAAGAGTGAGGGAGG + Intergenic
915461702 1:156074599-156074621 TTGTGGGTAAAGAGTGGAGAGGG + Exonic
921663217 1:217833186-217833208 TTTTTGCTAATGAGTTCTGAAGG - Intronic
923737742 1:236627450-236627472 TGTTAGGTAATGAGTGCTAAGGG - Intergenic
1064279063 10:13934502-13934524 TTTTGGTTAATGAATGTGAAAGG - Intronic
1065313855 10:24442699-24442721 TTTTGGGGAATGTGGGAGGAGGG + Intronic
1066304470 10:34126911-34126933 TTTCCGGTAATGAGTGAGCAGGG - Intronic
1066355178 10:34676465-34676487 TTTTGGGGGATGTGTGTGGATGG - Intronic
1080384771 11:31804817-31804839 TTTTTTGAAATGAGTGAGGAGGG - Intronic
1083485289 11:62979672-62979694 TATTGGGTTATGTGTGGGGATGG + Intronic
1086522875 11:87690582-87690604 TTTTGTGTAAGGTGTGAGGAAGG - Intergenic
1087442258 11:98201566-98201588 TTTTGGGTAAGGTGTTAGGAAGG + Intergenic
1087769220 11:102189451-102189473 TTTTAGGAAATAAGTGCTGATGG + Intronic
1094256785 12:28439526-28439548 TTTTGTGTATTGTGTGTGGAGGG - Intronic
1095918261 12:47502518-47502540 TTTTGTGTAATGTGTAAGGAAGG - Intergenic
1100900458 12:99234790-99234812 TTTTGGGTACTGAGTGTGGTTGG - Intronic
1101118201 12:101552567-101552589 TTTGGAGCAATGAGTGGGGAAGG + Intergenic
1103774168 12:123353161-123353183 TTTTGGGCAGGGAGTGAGGAAGG + Intronic
1109555517 13:63969917-63969939 CTTTGGGTAATGAGGGGGAAGGG + Intergenic
1111278667 13:85988777-85988799 TTATGGGGAAGGAGTGGGGAAGG + Intergenic
1113619363 13:111702480-111702502 GTTTGGGTAATGAGGACGAAGGG - Intergenic
1113624892 13:111787741-111787763 GTTTGGGTAATGAGGACGAAGGG - Intergenic
1116557668 14:46333391-46333413 TTTGAGGTAGTGAGTGGGGAGGG + Intergenic
1117350483 14:54876717-54876739 TTTTGTGTAATGAAAGTGGAAGG + Intronic
1118616620 14:67578434-67578456 GTTTGGGGAAAGAGTGCTGAAGG + Intronic
1120734815 14:88041086-88041108 TTCTGGAGAATGAGTGCAGATGG - Intergenic
1122499525 14:102187537-102187559 TTTGGGGTAATGTATGTGGAGGG + Intronic
1122849003 14:104516590-104516612 GTCTGGGGAATGAGAGCGGATGG + Intronic
1124272798 15:28298477-28298499 TTTTGTGGAATGAATGGGGATGG - Intronic
1124357793 15:29009840-29009862 TTTTGGGTCATGATTGCTGCTGG + Intronic
1125199785 15:37093228-37093250 TTTTGTGTAATCAGTGCAGCAGG - Intronic
1133640616 16:7713540-7713562 TTTGGGAAAATGAGTGAGGAAGG - Intergenic
1135711978 16:24725467-24725489 TTGTGGGTTATCAGTGCGGAGGG - Intergenic
1136489721 16:30598974-30598996 TTCTGGGTAATGAGTGGCAAGGG + Intergenic
1139284748 16:65801704-65801726 TTTTGGGTACTAAGAGGGGAAGG + Intergenic
1140554232 16:75902311-75902333 TTTTGTGTATTGTGTGAGGAAGG + Intergenic
1146230802 17:31107213-31107235 TTTTGGGTAATGAGTGCGGAGGG + Intronic
1147963766 17:44182104-44182126 TTTTAGTAAATGACTGCGGAAGG + Intergenic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1155193021 18:23448058-23448080 TTCTAGGGAATGAGTGGGGAGGG - Intergenic
1156757227 18:40542279-40542301 TTTTGGGTAAGGAGTGTGAATGG - Intergenic
1157481406 18:48056717-48056739 TTTGGTGTAAGGAGTGAGGAAGG - Intronic
1158258861 18:55586794-55586816 TTTGGGGTAATCAGTGGGTAGGG + Intronic
1159350661 18:67268800-67268822 TTTTGGTGAATAAGTGCTGATGG + Intergenic
925425838 2:3748140-3748162 GTTTGGGTAGTGAGTGTGGTGGG + Intronic
928634892 2:33234870-33234892 TTTTGTATAATGTGTGAGGAAGG - Intronic
930649156 2:53947188-53947210 TTTTTGAAAATGAGTGCAGATGG - Intronic
930758219 2:55001559-55001581 ATTTAGGTAATGAGTGAGGCTGG - Intronic
931459000 2:62433913-62433935 TTTGAGGAAATGAGTGAGGAGGG + Intergenic
937364009 2:121247958-121247980 TTTAGGGAAAGGAGTGGGGAGGG - Intronic
938887658 2:135669318-135669340 TTTTGGGTAGTTAGTTCAGATGG - Intronic
941415420 2:165214882-165214904 ATTTTGGTAATGAGTGCATATGG + Intergenic
941492187 2:166155902-166155924 TTTTGGGAAAGGACTGAGGATGG - Intergenic
942535895 2:176963505-176963527 TCCTGGGTAATTAGTGCAGAAGG - Intergenic
945626331 2:212211724-212211746 TGTTGGGGTATGAGTGGGGAGGG - Intronic
945913066 2:215671420-215671442 TATTGAGGAATGAGAGCGGAAGG + Intergenic
948359044 2:237405478-237405500 TGTCGGGGAATGAGCGCGGATGG - Intronic
1168919521 20:1519741-1519763 TTTTGGGGAAGGACTGTGGAGGG + Intergenic
1179344118 21:40540180-40540202 TTTTGGGTTGTGTGTGCGAAGGG - Intronic
1181995119 22:26872031-26872053 TTTTGTGTAATGTGTGAGGTAGG + Intergenic
1182410548 22:30181421-30181443 TTTAGGGAAAGGAGTGGGGAGGG - Intergenic
1185282335 22:49978752-49978774 TTTTGTGTAAGGAGTGAGGTAGG + Intergenic
950287366 3:11755361-11755383 TTGTGGGGAAGGAATGCGGAAGG + Intergenic
958958909 3:100490700-100490722 TTGATGGTAATGAGTGTGGAGGG + Intergenic
959849225 3:111068815-111068837 TTTTGGGTTAAGAGTACTGATGG - Intergenic
960411874 3:117336920-117336942 TTTTGTGTAATGTGTAAGGAAGG - Intergenic
963689708 3:148483106-148483128 TTTTGTGTAAGGTGTGAGGAAGG - Intergenic
970049146 4:11893309-11893331 TTTTGTGTAAGGTGTGAGGAAGG - Intergenic
971128749 4:23782497-23782519 ATTTGGTTTATGAGTCCGGAGGG - Intronic
975229391 4:71913647-71913669 TTGTGTGTAGTGAGTGAGGAGGG + Intergenic
975322779 4:73027031-73027053 TTTTGTGTAAAGTGTGAGGAAGG - Intergenic
976078301 4:81324127-81324149 TTTTGTGTAATGTGTAAGGAAGG - Intergenic
976083870 4:81387420-81387442 TTTTGTGTAAGGCGTGAGGAAGG - Intergenic
980142738 4:128940154-128940176 TTTTTTATAATGAGTGGGGATGG - Intronic
981289682 4:143059841-143059863 TTTTGTGTAAGGCGTGAGGAAGG - Intergenic
981832181 4:149015050-149015072 ATTTGGGTATTGAGTTCTGATGG + Intergenic
983234724 4:165166252-165166274 TTTTGTGTAAGGTGTGAGGAAGG - Intronic
983457647 4:167984937-167984959 TTTTGGGTAAAGAGAAGGGATGG - Intergenic
984924564 4:184795208-184795230 TTTTGGACAATGGGTGCTGAAGG + Intronic
988425230 5:31056107-31056129 TTTGGGGAAACGAGTGCGAATGG - Intergenic
990069495 5:51763100-51763122 TCTAGGGTGATGAGTGGGGATGG - Intergenic
992157141 5:73966779-73966801 TTTCTGGTCATGAGTGGGGATGG + Intergenic
999616485 5:153430242-153430264 TTTTGGTTTAGGAGTGGGGAAGG + Intergenic
1002426622 5:179180613-179180635 TTCTGGGTAATGAGGGCAGGGGG - Intronic
1003083029 6:3037558-3037580 TTTTGGGTATTGTATGAGGAAGG - Intergenic
1009818574 6:68769652-68769674 TTTTGGGATATGTGTGCAGAAGG - Intronic
1010313705 6:74420349-74420371 TTCTGGTTAATCAGTGCTGAAGG - Intergenic
1013864244 6:114675535-114675557 TTTTGGGTAAGATGTGGGGAAGG + Intergenic
1015093157 6:129383830-129383852 TTTTGGGGGGCGAGTGCGGATGG - Intronic
1019057900 6:169236184-169236206 TATGGGGCAATGAGTGTGGATGG - Intronic
1019057946 6:169236388-169236410 TATGGGGGAATGAGTGTGGATGG - Intronic
1019058001 6:169236679-169236701 TATGGGGGAATGAGTGTGGATGG - Intronic
1020357959 7:7298174-7298196 TTTTGTGTAATGTGTAAGGAAGG + Intergenic
1026003930 7:66585499-66585521 ATTTGGTGAATGAGTGCAGAGGG - Intergenic
1026252049 7:68679621-68679643 TTTTGGCTAAGGAGTGAGCAGGG - Intergenic
1029104096 7:98160661-98160683 TTTGGGGGAAGGAGTGTGGAGGG + Intronic
1031468492 7:122143238-122143260 TTGTGGGTTATCAGTGGGGAAGG - Intronic
1035017243 7:155777389-155777411 TTGTGGGTATTGAGTGAGGTCGG - Exonic
1035110102 7:156474669-156474691 CTTTAGGTAATGAGAGAGGAAGG - Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1037601722 8:20401892-20401914 TTTTGTGTAAGGTGTGAGGAAGG + Intergenic
1039357134 8:36831931-36831953 TTTTGTATAATGTGTGAGGAAGG + Intronic
1044659064 8:94578040-94578062 TTTTGGGTAATGGGGGCAAATGG - Intergenic
1044832491 8:96262987-96263009 TGTTAGGTAATGAGTGAGCAGGG - Intronic
1046332749 8:112742118-112742140 TTGTGAGAGATGAGTGCGGAGGG - Intronic
1046810791 8:118531099-118531121 TTTTGTGTAAGGTGTGAGGAAGG + Intronic
1051299479 9:15632992-15633014 TTTTGTGTAATGGGTAAGGAAGG - Intronic
1051836633 9:21345773-21345795 TTTTGGATAATGTGTAAGGAAGG - Intergenic
1054706353 9:68466604-68466626 TTTGGGGCAATTAGTGTGGAAGG + Intronic
1057043073 9:91861577-91861599 TTTTGTGTACTTAGTGAGGAAGG - Intronic
1057412393 9:94828392-94828414 TTTTGTGTAAGGTGTGAGGAGGG + Intronic
1057813532 9:98276719-98276741 TTTTGGGTAAGGTATGCGTAAGG - Intergenic
1188833198 X:34926535-34926557 TTTGGTGTAAAGAGTGAGGAAGG + Intergenic
1190551000 X:51580621-51580643 TTTTGTGTAATGTGTAAGGAAGG - Intergenic
1192967801 X:76197767-76197789 TTTTGGGGACTCAGTGGGGAAGG - Intergenic
1193647107 X:84082917-84082939 TTTTGTGTAAGGTGTGAGGAAGG - Intronic
1201561069 Y:15317459-15317481 TTTTGTGTAAGGTGTACGGAAGG + Intergenic