ID: 1146231540

View in Genome Browser
Species Human (GRCh38)
Location 17:31115244-31115266
Sequence GGGGCTGTCCTGTGCATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2537
Summary {0: 1, 1: 45, 2: 268, 3: 753, 4: 1470}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146231540 Original CRISPR GGGGCTGTCCTGTGCATTTC AGG (reversed) Intronic
Too many off-targets to display for this crispr