ID: 1146233505

View in Genome Browser
Species Human (GRCh38)
Location 17:31134749-31134771
Sequence ATGGAGAAGCCCAAGTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 1, 2: 5, 3: 43, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146233505_1146233508 -4 Left 1146233505 17:31134749-31134771 CCTTTCTACTTGGGCTTCTCCAT 0: 1
1: 1
2: 5
3: 43
4: 322
Right 1146233508 17:31134768-31134790 CCATCTGGCTGCTTGTAATGTGG 0: 1
1: 0
2: 5
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146233505 Original CRISPR ATGGAGAAGCCCAAGTAGAA AGG (reversed) Intronic
902687122 1:18085452-18085474 GTGGAGAAGCCCATGTAGCAAGG - Intergenic
903676791 1:25069338-25069360 ATGGAGAGGCCCACCTAGAGAGG - Intergenic
903777751 1:25804085-25804107 ATCTAGAAACCCAAGAAGAAGGG - Intronic
904108761 1:28108246-28108268 ATGGAGAGGCCTATGTAGCAGGG - Intergenic
904687671 1:32272675-32272697 AGGGAGAACCACAAGTACAAAGG + Intronic
905384903 1:37595800-37595822 ATGGTGAAGCCCAAGTACAAAGG - Exonic
907640181 1:56181177-56181199 ATGGAGAAGATACAGTAGAAAGG + Intergenic
909440866 1:75694095-75694117 ATGGAAATGACCAAGCAGAAAGG + Intergenic
912998161 1:114552416-114552438 ATGGAGAAGTCCATGTGGCAAGG - Intergenic
916956884 1:169847022-169847044 ATAGGGAAGCCCAAGGAGAGGGG + Intronic
918625611 1:186653133-186653155 CTGGAGAAGCCAAAGAAAAAGGG - Intergenic
920550907 1:206859904-206859926 ATTAAGAAAGCCAAGTAGAAAGG + Intergenic
920626119 1:207601925-207601947 TTGGAGAAGCCCATGTAGTGAGG - Intronic
921108295 1:212006353-212006375 ATTGAGAAGCCCAATTACATTGG - Intronic
921195009 1:212747388-212747410 ATGGAGAGGCCCACGTTGTAAGG + Intronic
923543834 1:234909471-234909493 ATGGTGGAGCCCAGGTAGATAGG - Intergenic
924461779 1:244266121-244266143 GTGGAGAGGCCCACGTAGCAAGG + Intergenic
1063105572 10:2988751-2988773 ATGGAGAGGCACAACTAGAAGGG + Intergenic
1063666037 10:8061304-8061326 AGGGAGATGCCCAACTGGAAAGG - Intronic
1064688354 10:17887504-17887526 CTGAAGAAGCGAAAGTAGAATGG + Intronic
1065283759 10:24167149-24167171 CTAGAGAAGTCCAAGCAGAAAGG - Intronic
1065379819 10:25078590-25078612 AAGCAGCAGCCCAAATAGAAGGG - Intergenic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1067900626 10:50237283-50237305 GTGGAGAAGCCTAAGTGGATAGG + Intronic
1067907482 10:50308789-50308811 ATTGAGAATCCAAGGTAGAAAGG - Intronic
1068629974 10:59288710-59288732 AAGAAGATCCCCAAGTAGAAGGG + Intronic
1068813711 10:61285918-61285940 GTGGAGAAGCCCACGTGGTAGGG - Intergenic
1069506141 10:68999690-68999712 ATGGAGAAGCCCATATGGAAAGG - Intronic
1070044536 10:72819092-72819114 AGGGAGAAGTCCATGAAGAATGG + Intronic
1072252722 10:93594368-93594390 ATGGTGAAGCGACAGTAGAACGG - Intronic
1072759847 10:98047502-98047524 ATGGAGAGGCCCACGTGGTAAGG + Intergenic
1073442545 10:103561101-103561123 ATGGAGAAGCCCGTGTGGCAAGG - Intronic
1075473882 10:122716291-122716313 AGGGAGAAGCCGAAGTGAAATGG + Intergenic
1076005505 10:126945336-126945358 ATGGAGAGGCCCACGTGGGAAGG - Intronic
1076051608 10:127338095-127338117 AAGGAGCAGCCAGAGTAGAAGGG - Intronic
1076054751 10:127363162-127363184 TGGGAGAAGCCCAAGTACTAGGG + Intronic
1078177569 11:8981645-8981667 ATGGAGAGGCCTCAGTGGAAAGG + Exonic
1078294378 11:10052361-10052383 ATGGTGAAGTCAAGGTAGAAGGG - Intronic
1079122063 11:17693122-17693144 ATGGAGAAGCCCACATGGCAAGG + Intergenic
1079314160 11:19393442-19393464 ATGGAGCACAGCAAGTAGAATGG - Intronic
1080074520 11:28133678-28133700 ATGGAGAGGCCTATGTAGAGTGG + Intronic
1080133213 11:28820638-28820660 ATAGAGAAGCCCACTTAGCAAGG + Intergenic
1081101714 11:39010335-39010357 ATGGAGAAGCCAAAGGAAATAGG - Intergenic
1081189574 11:40086751-40086773 ATGGAGAGGCACATGTAGCAAGG + Intergenic
1081552604 11:44127895-44127917 ATGGTGAACACCCAGTAGAATGG - Intronic
1081588308 11:44402854-44402876 CTGGAGGAGGCCAAGTAGATGGG - Intergenic
1081843081 11:46217612-46217634 AGAGAGAAGCCCAAGTGCAAAGG + Intergenic
1082645791 11:55723077-55723099 ATGGCGAAACACAAGTAGAAAGG + Intergenic
1082811425 11:57481441-57481463 ATGGCGAAGCCCTAGCAGAGGGG + Intergenic
1083640160 11:64141150-64141172 ATGGAGAATCCACAGTAGATGGG + Intronic
1083759187 11:64806518-64806540 AGGGAGGAGACCAGGTAGAAGGG - Intronic
1085023476 11:73223246-73223268 ATGGAGAATCCAAGGTGGAAAGG - Intronic
1088990755 11:114951383-114951405 ATGGAAGAGCCCATGTAGTAAGG - Intergenic
1089390725 11:118099819-118099841 ATGGTGAAGGCCAAGCTGAAGGG - Intronic
1090239543 11:125172291-125172313 ATTGAGAAGCCAACGTGGAAAGG - Intronic
1091651423 12:2313153-2313175 GTGGAGAAGCCCAAGCTGGATGG - Intronic
1092904692 12:13090824-13090846 ATAGACAAGCACAAGTGGAAGGG + Intronic
1093167228 12:15818024-15818046 ATGGAGAAACTCATGTGGAAAGG - Intronic
1095616208 12:44192386-44192408 AGGGAGAAGACCAAATAAAATGG + Intronic
1095754590 12:45750214-45750236 ATAGGGATGCCCAAGGAGAAGGG + Intronic
1097163348 12:57066596-57066618 ATAGGGAGGCCCAAGAAGAAGGG + Intronic
1097355766 12:58599754-58599776 ATGGAGAAAACCATGTAGTAGGG + Intronic
1097867779 12:64573665-64573687 TTGGAGAGGCCCAAATAGCAAGG - Intergenic
1098199628 12:68040965-68040987 ATGGAAAGGGCCAAGTGGAAAGG - Intergenic
1098538894 12:71629029-71629051 ATGGAGGAGCTAAAGTAGATAGG + Exonic
1098924852 12:76338056-76338078 AAGGAGAGGCCCATGTAGAGAGG - Intergenic
1100173804 12:92007086-92007108 TGGGAGGAGGCCAAGTAGAAAGG + Intronic
1101708861 12:107246393-107246415 GTGGAGAAGCTCAAGTGGCAAGG - Intergenic
1102426007 12:112844973-112844995 ATGGAGAGGCCCACGTGGAGGGG - Intronic
1102477057 12:113195603-113195625 AAGGAGAAGGGCAAGCAGAAAGG - Exonic
1103351568 12:120287378-120287400 ATGGAAAAGCCCTACTACAAGGG - Intergenic
1104892498 12:132147335-132147357 CTGGAGAAGTCCAAGTGGGAAGG + Exonic
1104991938 12:132629989-132630011 CTGGGGAGGCCCAAGGAGAAAGG + Intronic
1106171602 13:27293322-27293344 ATGCAGACGCCCACTTAGAATGG + Intergenic
1108006264 13:45949797-45949819 ATGAGGAAGCCAAAGTACAATGG + Intergenic
1108450647 13:50559373-50559395 TAGGAGAAGCCCAAGTATAGGGG + Intronic
1108637916 13:52354216-52354238 ATGCCCAAGCCCAAGTAAAATGG - Intergenic
1108944250 13:56002072-56002094 AAGGAGAGGCCCAAGCAGAAGGG + Intergenic
1109231365 13:59761948-59761970 TTGGAGAAACCCAAGTTGTAAGG - Intronic
1109959627 13:69613524-69613546 ATGGAGAAGCCCAAACTGATGGG + Intergenic
1110614304 13:77523964-77523986 ATGGCCAACCCCATGTAGAAAGG - Intergenic
1110660578 13:78055869-78055891 ATGGTGAAGTTCAAGTATAAGGG - Intergenic
1111487188 13:88919241-88919263 AAGGAGAAGTCCGAGTAAAATGG - Intergenic
1111671747 13:91340022-91340044 AAGGAGACGCCAAATTAGAATGG - Intergenic
1113106374 13:106775836-106775858 ATGGAGGAGCACAAGTGAAAAGG - Intergenic
1114441696 14:22753319-22753341 CTGGAGTAGACCATGTAGAAGGG - Intergenic
1115137461 14:30128102-30128124 ATGGAGAGGACCACGTAGCAAGG + Intronic
1116584860 14:46690460-46690482 ATGGAGAAGCCTAATTCAAAAGG + Intergenic
1116588937 14:46746408-46746430 ATGGAGAGGCCCCAGTGGCAAGG - Intergenic
1116698960 14:48213464-48213486 ATGGAGCATGCCAGGTAGAAAGG + Intergenic
1117876698 14:60258757-60258779 AGGGAGAAGCCAAGGTATAATGG + Intronic
1118853870 14:69606178-69606200 AAGGAAAAGCCAAGGTAGAAAGG - Intergenic
1119631299 14:76234553-76234575 TTGGAGAAGCCCAAGTGGCAAGG + Intronic
1120802903 14:88712892-88712914 CTGGAAAAGACCAAGAAGAAAGG + Intronic
1120878728 14:89398088-89398110 TTGGGGAAGCCAAAGGAGAAGGG - Intronic
1121076541 14:91073669-91073691 ATGGAGGGGACCAAGTGGAAAGG + Intronic
1121111143 14:91313936-91313958 TTGGAGCAGGCCAAGGAGAAGGG - Exonic
1121134480 14:91483207-91483229 AAGTAGAAGGCCAAGTAGAATGG + Intronic
1121831043 14:97052888-97052910 ATAAAGAAGCCCATGTCGAATGG - Intergenic
1121847806 14:97188737-97188759 ATGTAGAAGCTCAAATACAAAGG - Intergenic
1122395456 14:101425583-101425605 TTGGAAAAGCCCATGTAGCAAGG - Intergenic
1122608743 14:102966432-102966454 AGGGAGAAGCCAAACAAGAAGGG + Intronic
1122931649 14:104935734-104935756 ATGAAGAGGCCCATGTAGCAGGG + Exonic
1123986762 15:25653153-25653175 ATGGAGAAGAACGAGGAGAACGG - Intergenic
1125093874 15:35828494-35828516 AGGCAGCAGCCTAAGTAGAATGG - Intergenic
1126370347 15:47939281-47939303 ATGGAAATGACCAAATAGAAAGG + Intergenic
1127921776 15:63500465-63500487 TAGGAGCAGACCAAGTAGAAGGG + Intergenic
1128319462 15:66682782-66682804 ATGGAGAAGCCCAAATGGCAAGG + Intronic
1129054383 15:72808481-72808503 GTGGAGAGGCCCAAGTGGAGGGG + Intergenic
1130562340 15:84968435-84968457 AAGGAGAGGCCCATGTAGAGAGG - Intergenic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131107439 15:89744644-89744666 ATGGAGAAGCCCACGGGGACTGG - Intergenic
1131694000 15:94856111-94856133 CTGGAGCAGACCAAGAAGAAAGG + Intergenic
1131719045 15:95147212-95147234 CTGGAGAAGCCCAAAGAGTAGGG + Intergenic
1131874490 15:96790226-96790248 ATGGAGAAGCCCATGTGACAAGG - Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133389230 16:5395816-5395838 TGGGAGAAGCCCATGTAGCAAGG + Intergenic
1134909605 16:18012843-18012865 ATGGAGAATCCCAGGTGGTAAGG + Intergenic
1136172246 16:28496213-28496235 ATGGAGCAGTCCCAGGAGAAAGG + Exonic
1136477807 16:30524416-30524438 GTGGAGAAGCCGCAGGAGAATGG - Exonic
1137480263 16:48846724-48846746 TTGGAGAAGCCCACGTGGAAAGG + Intergenic
1137847931 16:51710240-51710262 ATCGAAAACCCAAAGTAGAAAGG + Intergenic
1138369216 16:56511573-56511595 ATGTTGAAGCTCAAGTACAAAGG - Intronic
1143035502 17:3993547-3993569 ATGGAGAAGCCCATGTGGCATGG + Intergenic
1144460592 17:15455668-15455690 ATGGAGAGGCCCATGTGGCAAGG + Intronic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1146617063 17:34365179-34365201 ATGGAAATGTCCAAGTTGAAAGG + Intergenic
1148885399 17:50768518-50768540 ATGGAGAGGCGGAAGTAGCAGGG + Intergenic
1148966875 17:51443115-51443137 AGGCAGAAGCCCAAGGAGACTGG - Intergenic
1149336009 17:55636869-55636891 ATGGAGAGGCCCAGGTAGCAAGG + Intergenic
1149839856 17:59952008-59952030 ATGGAGAAGACTAATTATAAGGG + Intronic
1150729124 17:67676586-67676608 TTGGAAAAGGCCAAGGAGAAGGG - Intronic
1150989777 17:70243814-70243836 ATGAAGAAGTCCAAGTGGCAAGG - Intergenic
1151897997 17:76993302-76993324 AAGGAGAAGCCCAGGAAGACTGG - Intergenic
1151903259 17:77031681-77031703 ATGGAGAAGCCCACGTGGTGAGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1156510647 18:37633882-37633904 ATGAAGGAGCCCCAGTAGAATGG + Intergenic
1156681518 18:39594891-39594913 ATGGAGAAGACCACATAGCAGGG - Intergenic
1157445654 18:47745112-47745134 AGGGAACAGCACAAGTAGAAAGG - Intergenic
1157921329 18:51715708-51715730 GTGGGTAAGCCCAAGCAGAAAGG + Intergenic
1158032674 18:52985848-52985870 AGGGAGAAGTCCAAGAAGAAAGG - Intronic
1158597757 18:58831124-58831146 ATGGAGTTGCCCAATTAGGATGG + Intergenic
1158840744 18:61383872-61383894 AGGGAGAAGCTGAAGTAGTAGGG + Intronic
1160968694 19:1757919-1757941 ATGGGGATGCCGGAGTAGAAAGG - Intronic
1162548468 19:11345331-11345353 ATGGAGATGTGGAAGTAGAAGGG + Exonic
1165652718 19:37505490-37505512 ATGGAGAGGCCCAGGTAGCAAGG - Intergenic
1165817074 19:38648747-38648769 ATGGAGAAGCCGAAGTAGAGGGG + Intronic
1167158146 19:47751561-47751583 CTGGAGCAGACCAAGAAGAAAGG + Exonic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167484935 19:49757189-49757211 ATGAAGAGGCCCATGTAGCAAGG + Intronic
925617812 2:5760365-5760387 ATGGGAAAGCCAAAGTAGGAAGG - Intergenic
925666931 2:6267703-6267725 ATGGAGAATTAAAAGTAGAATGG + Intergenic
926048112 2:9724977-9724999 CTGGAGAAGGCAAAGTGGAAAGG - Intergenic
926824418 2:16889694-16889716 AAGGAAAAGCCAAAGTAGAAAGG - Intergenic
926875399 2:17471164-17471186 ATGGAGAAGCCAAATTAAAGTGG - Intergenic
928619145 2:33071256-33071278 ATGGAGAGGCCCAGGTAGTGAGG - Intronic
928656132 2:33453500-33453522 ATGGAGAAGTCCACGAAGAAAGG - Intronic
929446841 2:42008807-42008829 ATGGAGAAGGGCAAATGGAAGGG + Intergenic
929551425 2:42895515-42895537 ATGCAGGACCCCAAGAAGAAGGG + Intergenic
929766442 2:44847852-44847874 AAGAAGAAGCCAAAGAAGAAGGG - Intergenic
930291998 2:49506281-49506303 GTGGAGGAGCCAAAGTAGTAAGG - Intergenic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
932880234 2:75494520-75494542 ATGGGGAAGTCCAAGTGGCAAGG + Intronic
933367280 2:81368673-81368695 ATGGAGAAGAACAAATAGAGTGG + Intergenic
933920544 2:87041126-87041148 ATGAGGAAGCCCAAGAAAAAGGG + Intergenic
933931080 2:87152660-87152682 ATGAGGAAGCCCAAGAAAAAGGG - Intergenic
934002453 2:87728772-87728794 ATGAGGAAGCCCAAGAAAAAGGG - Intergenic
934560974 2:95313152-95313174 ATGGAAAAACCCCAGTACAAGGG - Intronic
936362041 2:111812772-111812794 ATGAGGAAGCCCAAGAAAAAGGG + Intronic
936429709 2:112451652-112451674 ATGGAAAAGCCTATGTAGTAAGG + Intergenic
936544572 2:113379942-113379964 AGGGAGAAGCACAGATAGAAAGG - Intergenic
939433989 2:142149500-142149522 ATGTAGAAGACCAATTAGAAAGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
940351786 2:152698879-152698901 ATGAAGAACCCCAAGTAAAAAGG - Intronic
941552453 2:166934279-166934301 CTGGAGAAGCCCATGTAGCAAGG + Intronic
941924769 2:170884082-170884104 GTGGAGAGGCCCAAGTCGAGAGG + Intergenic
943314418 2:186369408-186369430 CTGGAGAGGCCCAAGTGGAGAGG - Intergenic
943515444 2:188880286-188880308 TTGGAGAGGCCCAAGTGGCAAGG - Intergenic
944424252 2:199563083-199563105 ATGGCTCAGTCCAAGTAGAAAGG + Intergenic
944689938 2:202149638-202149660 ATGGGGAACCCCAATTAGAAAGG + Intronic
945511155 2:210704386-210704408 ATGGAAAAGCACAGGTAGAGGGG + Intergenic
946374081 2:219297735-219297757 CTGGAGAAGCCCCAGTGGGAGGG - Intronic
946400610 2:219466508-219466530 ATGGAGGGGCCCAAGGAGCAGGG + Intronic
946978218 2:225176919-225176941 ATGGAGAACCCCAGGTACTATGG - Intergenic
948489475 2:238303237-238303259 ATGGAGACGACAAAGAAGAATGG - Intergenic
948493407 2:238329028-238329050 AAGGAGAAGGCCAAGGAGAATGG + Exonic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1170798993 20:19574930-19574952 AGGGAAATGCCCAAGTAGCAGGG - Intronic
1172468060 20:35171863-35171885 AGGAAGCAGCCCAAGGAGAAGGG + Intergenic
1172990481 20:39032523-39032545 ATGGAGAAGCCCTGGGAAAAAGG + Intronic
1173130230 20:40385746-40385768 AGGGAGAACCCAAAATAGAATGG + Intergenic
1173840872 20:46156209-46156231 ATGGAGAGGCCCACGTGGCAAGG + Intergenic
1175002206 20:55641668-55641690 ATGGAGAGGCCCATGTGGCAGGG + Intergenic
1175142097 20:56868364-56868386 GTGGAGATGCCCACATAGAAAGG - Intergenic
1175518590 20:59585080-59585102 ATGCAAAAGCCCGAGTGGAAAGG - Intronic
1179502903 21:41821169-41821191 ATGGAGGTGCACAAGGAGAAGGG - Exonic
1182336681 22:29588181-29588203 CTGGAGAAGCCCATGTAGCAAGG - Intergenic
1182488263 22:30652691-30652713 ATGGAGAAGCCCACATGGCAAGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184605679 22:45573377-45573399 ATGAAGAAACCCAAGTAGGCCGG + Intronic
949266261 3:2160096-2160118 ATGGAAAAGCTAAAGTAGACTGG + Intronic
949831719 3:8221886-8221908 ATGGAGAGGCCCATGTGGCAGGG + Intergenic
949921026 3:9000544-9000566 TTGGAGAAGTTCAAGTCGAAGGG + Intronic
950189058 3:10963879-10963901 ATGGAGAGGCCCATGTAGTGAGG - Intergenic
950343665 3:12272202-12272224 ACAGAGAAGTCCAAGAAGAAAGG - Intergenic
951362388 3:21740526-21740548 ATAAAGGATCCCAAGTAGAAAGG + Intronic
951655985 3:25009071-25009093 AGGGACAAGCCAAATTAGAAGGG - Intergenic
951819682 3:26794307-26794329 CTGATGAAGCCCAAGTAGATGGG - Intergenic
954232901 3:49232214-49232236 AAGGACAAGCCATAGTAGAAAGG + Intronic
954447231 3:50553294-50553316 ATGGTGTACCCCAGGTAGAAGGG + Intergenic
955379950 3:58430132-58430154 TTGGAAAAGCCAAAATAGAAAGG - Exonic
956021868 3:64941649-64941671 ATGGAGAGGCCCACATAGCAAGG - Intergenic
957227731 3:77471510-77471532 ATGGAGAAGCCCATTTGGCAAGG - Intronic
958166510 3:89884221-89884243 ATGCACAAGCCTCAGTAGAAAGG - Intergenic
958838092 3:99170898-99170920 ATGGAGAAGAACAAGTGGATTGG + Intergenic
959227009 3:103599094-103599116 ATGGAGAATCCCAAGATGAAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961579875 3:127872006-127872028 AGAAAGAAGACCAAGTAGAAAGG + Intergenic
962097998 3:132312013-132312035 TTGGAGGGGCCCAAGTAGCAAGG + Intergenic
962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG + Intronic
962660125 3:137593655-137593677 ATGGAAAAGTCCATGTAGAATGG + Intergenic
962679696 3:137785453-137785475 ATGGAGAGGCCCAGGTGGGAGGG - Intergenic
963859832 3:150297766-150297788 ATGGAAAGGCCCAAGAATAAGGG - Intergenic
963864215 3:150342891-150342913 ATGGAGAGGCCCATGTGGCAAGG - Intergenic
964784242 3:160376766-160376788 ATGGAGATGCCCATGTGGCAAGG + Intronic
964839807 3:160981380-160981402 ATGAAGAAACCCATGTAGACAGG - Intronic
964986293 3:162744226-162744248 ATGGAAAAGCCCATGCTGAATGG - Intergenic
965259365 3:166460589-166460611 ATGAAGAAACACAAGTAGACAGG - Intergenic
965677509 3:171213279-171213301 TTGGGGAAGCCTAAATAGAAAGG + Intronic
966034260 3:175391462-175391484 TTGGAGAAGCTCATGTAGCAAGG + Intronic
966141121 3:176757393-176757415 CTGGTGAAGCCGGAGTAGAATGG + Intergenic
966949696 3:184805007-184805029 ATGGAGAAGCCCATGTGACAAGG + Intergenic
967234740 3:187373239-187373261 ATAGAGAAGGGCAAGGAGAATGG + Intergenic
967884901 3:194326382-194326404 AGGGAGAAGAGCAAGTGGAATGG + Intergenic
969081539 4:4622432-4622454 GTGGAGAACCCCATGTAGAGAGG + Intergenic
970655286 4:18224413-18224435 AGGGAGAAACCAGAGTAGAAAGG - Intergenic
970744471 4:19278874-19278896 ATGGAGAAGACCATGTGGCAGGG - Intergenic
971044590 4:22791223-22791245 GTGGAGAAGTCCAAGAAGAAAGG + Intergenic
971381110 4:26098801-26098823 ATGGAGAGGCCCATGTGGCAAGG - Intergenic
972189345 4:36571152-36571174 ATAGAGAGGCCCAAGGAGAGGGG + Intergenic
972293860 4:37717687-37717709 ATGGAGAAGCCCATGTGCATAGG + Intergenic
972832714 4:42832977-42832999 ATGGAGAACCTCTAGTAGGATGG + Intergenic
974777089 4:66498727-66498749 ATGAAGAAGCCAAAGAAAAAAGG + Intergenic
975468819 4:74740486-74740508 ATGGAGATGCCAAAGTTGAGAGG + Intergenic
975620953 4:76295935-76295957 ATGGAGAGGCCCACATAGCAAGG + Intronic
976129014 4:81864627-81864649 ATGGAGAAAGCCAATTAAAAGGG + Intronic
976264118 4:83173993-83174015 CTGGAGAAGCTCAAGAACAAGGG - Intergenic
977164956 4:93683155-93683177 AAGGAGAAGCCCAGGGAGAGAGG - Intronic
977764381 4:100779307-100779329 CTGGAGAAGTCCATGAAGAATGG + Intronic
978126326 4:105140122-105140144 ATGGAGAAGGCAAATTAAAAAGG - Intergenic
978912686 4:114082977-114082999 ATGGAGGAGCCCAAGAATGAAGG + Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
981341935 4:143631661-143631683 ATGGAGCAAAACAAGTAGAAAGG + Intronic
983822856 4:172217947-172217969 TTAGAGAAGCCCAAATACAAAGG - Intronic
986309706 5:6543145-6543167 ATGGAGCAGCCCAAGGACCAAGG - Intergenic
987283465 5:16434779-16434801 CAGGAGAAGACCAAGCAGAAAGG + Intergenic
988663761 5:33302314-33302336 ATGGAGAGGCCTAGGTGGAAAGG - Intergenic
989454595 5:41628383-41628405 ATAGAGAAGCCCAAGAATAAGGG + Intergenic
990816774 5:59794600-59794622 ATAGAGAAGGGCAAGAAGAATGG - Intronic
991507794 5:67343115-67343137 ATGGAGAAGCCACACCAGAAAGG + Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
992168714 5:74080754-74080776 ATGGAGCAGACCAAATGGAAAGG - Intergenic
992640795 5:78766989-78767011 ATGGGCCAACCCAAGTAGAAGGG + Intronic
992882314 5:81122685-81122707 AATGAAAAGCCCAAGAAGAATGG + Intronic
994852701 5:105075895-105075917 ATTGAGACACCCAAGTATAAAGG - Intergenic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995635102 5:114179335-114179357 ACGGAGAAGCACATGTGGAAAGG - Intergenic
996465963 5:123803050-123803072 GGGGAGAAGGCCAAGGAGAAGGG - Intergenic
997317965 5:132953829-132953851 AAGTAGAAGTCCAATTAGAAAGG - Intronic
998038647 5:138937114-138937136 ATGGAGGAGCCCAGGGAGCAAGG - Intergenic
998226763 5:140333148-140333170 ATGGAGTAGCACCAGAAGAATGG + Exonic
998765131 5:145478083-145478105 ATGGAAATGAACAAGTAGAAAGG - Intronic
999551552 5:152692923-152692945 ATAGGGAGGCCCAAGGAGAAGGG + Intergenic
999657477 5:153825013-153825035 GTGGGGAAGGCCAAGTTGAAAGG - Intergenic
1000560785 5:162786321-162786343 ATGAAGAAGCCCATGTGGAAAGG - Intergenic
1000810132 5:165851234-165851256 ATGAAGAAGCTAAGGTAGAAAGG + Intergenic
1003424384 6:5987938-5987960 GTGGAGAAGCCCACATAGAAAGG - Intergenic
1003458582 6:6307739-6307761 AGCTAGAAGCCCAAGTAGTAGGG - Intronic
1004112692 6:12735186-12735208 ATGGAGAGGCTCATGTAGCAAGG - Intronic
1005015490 6:21371463-21371485 ATGGAGATGACCAAGGAGAGAGG - Intergenic
1005679069 6:28187536-28187558 ATGGAGAAACCCATGTTGTAAGG - Intergenic
1006869385 6:37236928-37236950 ATGGAGAAGCCCACATGGATGGG - Intronic
1007697598 6:43743712-43743734 CTGGAGAAGCCCTAGTGGGAAGG - Intergenic
1008438440 6:51503920-51503942 ATGGAGAAGCCCACATAGCAAGG + Intergenic
1009730184 6:67592512-67592534 ATTGAGAAGTTCAAGTTGAAGGG - Intergenic
1009828719 6:68901305-68901327 ATGGAGAGGCCCATGTTGCAAGG - Intronic
1009897510 6:69771327-69771349 ATGGAGAGGCCCACATAGCAAGG - Intronic
1010345237 6:74802711-74802733 ATGGAGAAGCCATAGTAAAATGG + Intergenic
1010502472 6:76617682-76617704 ATGGAGTAGCCAAGGAAGAATGG + Intergenic
1013196805 6:107851219-107851241 ATGGAGAGGCCCAAGTAGTGAGG - Intergenic
1015169666 6:130238715-130238737 ATGGAGAAGACAAGGTAGATGGG + Intronic
1015180398 6:130355744-130355766 ATGGAGAAGCACCAGTAAGAGGG + Intronic
1015214182 6:130731227-130731249 ATGGAGAAGGCCATGAAGAGAGG + Intergenic
1015214493 6:130734239-130734261 ATGGAGAAGGCCATGAAGAGAGG + Intergenic
1015887543 6:137933775-137933797 ATTGAGAAGCCAAAATAGGAAGG - Intergenic
1017410801 6:154165860-154165882 GTGGAGAAGCCCATGTGGCAAGG + Intronic
1019444270 7:1063065-1063087 ATGGAGGAGCCCAGAGAGAACGG - Intronic
1019742211 7:2680549-2680571 CTGGAGATGCCCAAGGAGTAGGG + Intronic
1019862059 7:3668383-3668405 ATGGAGAGGTCCATGTAGAAAGG - Intronic
1020652611 7:10893684-10893706 ATGGAAAAGTCTCAGTAGAAAGG - Intergenic
1022214836 7:28248635-28248657 ATGGAGAAGTCCAACTTGAATGG + Intergenic
1022770438 7:33466343-33466365 CTAAAGAAGCCAAAGTAGAATGG - Intronic
1023630685 7:42161019-42161041 CTGTAGAAAACCAAGTAGAAGGG - Intronic
1023730495 7:43187141-43187163 ATGGAGAGGTCCAGGTAGCAAGG - Intronic
1025073064 7:55918213-55918235 ATGGAGAAGCCCATATGGAGAGG + Intronic
1025636017 7:63319763-63319785 ATGGAGAAATTCATGTAGAATGG - Intergenic
1025646679 7:63428417-63428439 ATGGAGAAATTCATGTAGAATGG + Intergenic
1028533798 7:91868377-91868399 ATGAAGAAGGCCATGAAGAAAGG - Intronic
1029049884 7:97674697-97674719 ACAGGGAAGCCCAAGGAGAATGG - Intergenic
1031013937 7:116551925-116551947 GTGGAGAGGCCCATGTGGAAAGG - Intronic
1031996859 7:128238370-128238392 ATGGAGAGGCCCTAGTGGAATGG + Intergenic
1032582767 7:133118413-133118435 ATGGAGAAGCCCATGTGGGAAGG + Intergenic
1032594496 7:133225890-133225912 ATGGAGAAGCTCATGTAGTAAGG + Intergenic
1034169096 7:149049011-149049033 ATGGAGAGGCCCATGTGGGAGGG + Intergenic
1036517896 8:9461888-9461910 ATGAAGAAGCCCAGGTAACAAGG + Intergenic
1037916074 8:22774260-22774282 ATGCAGAAGCCCAAAAGGAAGGG - Intronic
1038906212 8:31906238-31906260 ATGGAGAATCCCACGTGGTAAGG - Intronic
1039164560 8:34663015-34663037 ATAGTGAAGTCCAAGTAAAATGG + Intergenic
1040535984 8:48310355-48310377 ATGGAGAAGCCCAAAAGAAATGG + Intergenic
1040558067 8:48498663-48498685 TTGGTGAAGCCCATGTAGCAAGG - Intergenic
1040611614 8:48990020-48990042 ATGGAGAAGCTCAAGACTAACGG - Intergenic
1041215257 8:55594173-55594195 ATCCAGAAGCCCATGTAAAAAGG + Intergenic
1041267738 8:56081599-56081621 ATGGAGAAGCCCATGTAGCAAGG + Intergenic
1041927216 8:63249223-63249245 CTGGAGAGGCCCATGTAGCATGG + Intergenic
1042241135 8:66665975-66665997 AGGGATGAGCCCAGGTAGAAAGG + Exonic
1042681295 8:71387962-71387984 GTGAAGAAGTCCAAGAAGAAGGG + Intergenic
1046030119 8:108773705-108773727 ATGGAGAGGTCCAAGTAGTAAGG + Intronic
1046245760 8:111560382-111560404 TTGAAGAAGCCCAAGCAAAATGG + Intergenic
1047034509 8:120922382-120922404 ATAAAGAAGCCCAAGGAGACAGG + Intergenic
1047195331 8:122715824-122715846 TTGGAGAAGCCCATGTGGCAAGG + Intergenic
1047512046 8:125522825-125522847 ATGGAGAGGCCCAACTGGCAAGG + Intergenic
1048559325 8:135515857-135515879 ATGGAGAGGACAAAGTAGATAGG - Intronic
1048592267 8:135831821-135831843 ATGGAGAGGCCCAGGTGGTAAGG + Intergenic
1048724572 8:137368232-137368254 ATATATAATCCCAAGTAGAAAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048865491 8:138758118-138758140 ATGGAGAAGCCCATGTAAAAGGG + Intronic
1048921520 8:139235557-139235579 CTGGGGAAGCCCATGGAGAAAGG + Intergenic
1048987290 8:139741330-139741352 TTGGAGCAGCCCCAGTAGGAGGG + Intronic
1049013408 8:139903247-139903269 CTGGAGAAGCCCAAGGCAAATGG - Intronic
1050255111 9:3785990-3786012 ATGGAGAAGGGAAACTAGAAAGG - Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052637839 9:31125544-31125566 ATGGAGTATCCCAAGTAGAAAGG + Intergenic
1052775007 9:32724332-32724354 ATGGAGAGGCGCATGTGGAAAGG - Intergenic
1053421378 9:37981789-37981811 ATAGAGAGGCCCAAGGAGAGGGG + Intronic
1053601181 9:39611105-39611127 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1053858830 9:42364903-42364925 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1054250919 9:62716664-62716686 ATGGAGATGACCAAGCTGAAAGG - Intergenic
1054566470 9:66765833-66765855 AAGGAGAAGACCAAGGAGCAGGG + Intergenic
1054858253 9:69924162-69924184 GTGGAGAAGCCCAAGCCAAAGGG + Intergenic
1056494004 9:87137851-87137873 ATGTAAAAGCCCATGTAAAAAGG + Intergenic
1056803446 9:89710168-89710190 AGGGAGAAGCCTAAGTAGCCAGG + Intergenic
1059538950 9:115111752-115111774 TTGGAGAAGCCCATGTGGCAAGG + Intronic
1060127221 9:121059800-121059822 ATGGAGAAGCCCACGTAGAAAGG + Intergenic
1060250070 9:121979166-121979188 ATGGAGAGGCCCAGGTGGCAAGG + Intronic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1062066524 9:134530613-134530635 ATGAAGAGGCCCAGGTGGAAAGG - Intergenic
1186443911 X:9609463-9609485 CTGGAGAAGGTCAAGTGGAAGGG - Intronic
1187062511 X:15800978-15801000 ATGTAGATGGCCAGGTAGAAAGG + Intronic
1188401829 X:29755093-29755115 ATAGAGAAGCCCTTGTAGTAAGG - Intronic
1190437720 X:50442942-50442964 TTGGAGAAGCCCATGTAGCAAGG - Intronic
1191096183 X:56674710-56674732 AGGGAGAAGCCAGAGCAGAAAGG + Intergenic
1193735866 X:85155494-85155516 ATTGAGAAGCAAAAGTAAAACGG + Intergenic
1195285368 X:103377522-103377544 ATGGAGCAGCCTATGCAGAATGG + Exonic
1195309303 X:103615309-103615331 ATGGAGAAGTCCAAGTTCAAGGG + Intronic
1195681118 X:107547367-107547389 GTGGAGAAGGGGAAGTAGAAGGG - Intronic
1196603731 X:117631462-117631484 ATGGTGAAGCCCAAGGTAAATGG - Intergenic
1196770958 X:119292715-119292737 ATAGAGAAGCCCAAGAAGATAGG + Intergenic
1197851362 X:130864295-130864317 ATGGAGAAGCCCGTGTGGCAAGG + Intronic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198063903 X:133076686-133076708 ATGGAGAAGCCCAGGTGGCAAGG + Intronic
1198730120 X:139719599-139719621 ATGAGGAAAGCCAAGTAGAATGG - Intergenic
1199843857 X:151676618-151676640 TTGGAGAAGCCCAGAGAGAATGG + Exonic