ID: 1146234957

View in Genome Browser
Species Human (GRCh38)
Location 17:31150620-31150642
Sequence CAAAATGAGGAGAGGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1541
Summary {0: 1, 1: 2, 2: 6, 3: 177, 4: 1355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146234957 Original CRISPR CAAAATGAGGAGAGGGAGGG TGG (reversed) Intronic
900320875 1:2082996-2083018 GGACATGAGGAGAGGGAGGACGG - Intronic
900378929 1:2374067-2374089 CACCATGGGGAGAGGGAGGGTGG + Intronic
900887974 1:5428959-5428981 AAAGATGAGAACAGGGAGGGAGG + Intergenic
900892071 1:5456731-5456753 CAAAATGAGTGGTGGAAGGGAGG - Intergenic
901658658 1:10785299-10785321 AGAAATGAAGAAAGGGAGGGAGG - Intronic
901742423 1:11350948-11350970 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
902240960 1:15089081-15089103 TGAAAGGAGGAGAGGGAGAGAGG - Intronic
902364084 1:15959498-15959520 AAGAGGGAGGAGAGGGAGGGAGG + Intronic
902692022 1:18115896-18115918 AGAAAGAAGGAGAGGGAGGGAGG + Intronic
902743596 1:18457954-18457976 CAAGATGAGGGGACGGAGTGTGG + Intergenic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
903010764 1:20328522-20328544 GAAGAGGAAGAGAGGGAGGGAGG + Intronic
903076408 1:20770600-20770622 AAAAATGAGGCTAGGGATGGTGG - Intronic
903239016 1:21970194-21970216 GAAACTGCGGAGAGGGAAGGTGG - Intergenic
903242925 1:21995870-21995892 GAAACTGCGGAGAGGGAAGGTGG - Intronic
903333575 1:22610054-22610076 AAGAAAGAAGAGAGGGAGGGAGG - Intergenic
903410287 1:23137351-23137373 CAAAGTGAGGCGAGGCATGGTGG + Intronic
903483174 1:23669474-23669496 GAAAAAGAAGGGAGGGAGGGCGG + Intergenic
904083203 1:27885072-27885094 GAAAATGAGGATAGGGTTGGGGG - Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
904647947 1:31982351-31982373 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
904812010 1:33169528-33169550 CACAATGGGGAGAGTGAGAGGGG - Intronic
905204885 1:36337751-36337773 GAGAAGGATGAGAGGGAGGGAGG + Intergenic
905258388 1:36700383-36700405 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
905258414 1:36700476-36700498 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
905262337 1:36728798-36728820 AGAAAGGAGGAGAGGGAGGCAGG - Intergenic
905636706 1:39558800-39558822 CACAGGGAGGAGAGGAAGGGAGG + Intergenic
906039738 1:42778977-42778999 CAAAATGTGGGGGGGGGGGGGGG - Intronic
906139078 1:43522714-43522736 AAGAATGGGGAGAGGGAAGGGGG + Intergenic
906282697 1:44565280-44565302 GAAAATGCAGGGAGGGAGGGAGG + Intronic
906303787 1:44703345-44703367 GTGAATGGGGAGAGGGAGGGAGG - Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907103941 1:51863112-51863134 CAAAATGAGGCCAGGCATGGTGG + Intronic
907167383 1:52425856-52425878 CAAAATAGGGAGGGGGTGGGGGG + Intronic
907380421 1:54082706-54082728 GAAAGTGAGGGGAGGGAGGAAGG + Intronic
907581657 1:55577826-55577848 CAACAGGAGGAAAGGGTGGGTGG + Intergenic
907858486 1:58327278-58327300 GAAAAAGAAGAAAGGGAGGGAGG + Intronic
907966649 1:59337340-59337362 CAAAAGGGAGAGAGGGAGGAAGG + Intronic
908007312 1:59740074-59740096 CTGAAGGAGGACAGGGAGGGAGG - Intronic
908017513 1:59858894-59858916 AAAAACAAAGAGAGGGAGGGGGG + Intronic
908089096 1:60667859-60667881 CAGAGTGGGGAGAGGCAGGGGGG + Intergenic
908556287 1:65259783-65259805 CAAACTGAGGGGTGGGAGGATGG + Intronic
908767744 1:67569690-67569712 AAAAAAAAGGAGAGGGAGTGGGG + Intergenic
909418759 1:75438524-75438546 CTAAATGAGAAGAGGAAGTGGGG + Intronic
909447670 1:75765648-75765670 CCAAAAGAAGGGAGGGAGGGAGG + Intronic
909520971 1:76567031-76567053 AAGAATGAGGACAGGGAAGGAGG + Intronic
909589516 1:77330122-77330144 AAAAATGAAGAGAGGGAATGAGG + Intronic
909610969 1:77551526-77551548 CAAAATGAGGAGGGGGATTGGGG + Intronic
909700123 1:78512889-78512911 CAAAAGCAGGAGAGAGAAGGGGG - Intronic
909911196 1:81259898-81259920 CAAAATTAGGAGGCGGAGTGTGG - Intergenic
910229052 1:84967759-84967781 GAAAAAGGAGAGAGGGAGGGAGG + Intronic
910229060 1:84967788-84967810 GAAAAAGGAGAGAGGGAGGGAGG + Intronic
910513925 1:88037041-88037063 CAGAATGAGGAGAGTTAGGGTGG - Intergenic
910745373 1:90568717-90568739 CAGAAAGAGGAGTGGGAAGGTGG - Intergenic
910826068 1:91408569-91408591 AAAAAAGAAGGGAGGGAGGGAGG - Intergenic
911031738 1:93496240-93496262 GAAAAAGAGGAGAAGGAAGGGGG - Intronic
911268834 1:95775912-95775934 AAAAATGAGGTGATGGATGGTGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911417878 1:97598594-97598616 GAAAAAGAAGGGAGGGAGGGAGG + Intronic
911526551 1:98994289-98994311 CAAAAAGAGGAGAGTAAAGGAGG - Intronic
911540487 1:99151735-99151757 CGAAAGGAAGAGAGGGTGGGGGG + Intergenic
911735718 1:101334625-101334647 CAGAAGGGGGAGAGGGAGGGAGG - Intergenic
911832882 1:102576986-102577008 CAAAGTGAGGAGAGGGACTGGGG + Intergenic
912189620 1:107322658-107322680 CAAAATGAGCCAGGGGAGGGGGG - Intronic
912269362 1:108193331-108193353 CCAAAAGGGGGGAGGGAGGGAGG - Intronic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912720554 1:112016403-112016425 CAAAGTGAGCAGAGGGTTGGGGG - Intergenic
912932738 1:113979524-113979546 CAAGATGAGGAGAGGGGTGCTGG - Exonic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
913037701 1:114988184-114988206 CAGAAGGAGAAGAGGGAGAGAGG + Intronic
913142743 1:115957296-115957318 CAAAATGAGAAAAGGGATTGAGG + Intergenic
913537978 1:119792606-119792628 ATAAATTAGGAGAGGGAGGTGGG + Intergenic
913940354 1:125097998-125098020 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
913969122 1:143401057-143401079 AAAGAAGAAGAGAGGGAGGGAGG - Intergenic
913982510 1:143534480-143534502 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914063499 1:144226656-144226678 AAAGAAGAAGAGAGGGAGGGAGG - Intergenic
914115651 1:144739698-144739720 AAAGAAGAAGAGAGGGAGGGAGG + Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914718878 1:150272928-150272950 AAAAATGAGGAGTGGGTGAGAGG + Intronic
914770045 1:150675959-150675981 AAAAAGGAAGGGAGGGAGGGAGG - Intronic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
915168375 1:153961421-153961443 CACAATGGGGAGGGGGATGGAGG - Intronic
915326753 1:155084800-155084822 GAAAAGGAGGCGAGGGAGAGGGG - Intronic
915367571 1:155324371-155324393 GAAAGGGAGGAGACGGAGGGAGG - Intronic
915403696 1:155643260-155643282 CAAAAGCAGGAAAGGGAGTGAGG - Intergenic
915515509 1:156410242-156410264 AAAAAGGAAGGGAGGGAGGGAGG - Intronic
915557837 1:156670124-156670146 GAAAAGGAGGAGGGGGAGGAGGG - Exonic
916008437 1:160682525-160682547 GAAAAAGAAGGGAGGGAGGGAGG + Intronic
916107894 1:161443993-161444015 CAGAATGAGGGGAGAGAGTGTGG - Intergenic
916109479 1:161451375-161451397 CAGAATGAGGGGAGAGAGTGTGG - Intergenic
916111064 1:161458780-161458802 CAGAATGAGGGGAGAGAGTGTGG - Intergenic
916112652 1:161466166-161466188 CAGAATGAGGGGAGAGAGTGTGG - Intergenic
916115383 1:161481225-161481247 CAGAATGAGGGGAGAGAGTGTGG - Intergenic
916288976 1:163142779-163142801 CAAAGGGAGAAGAGGAAGGGAGG + Intronic
916386642 1:164280414-164280436 CCAAATGAAGGGAGGGAGGGAGG + Intergenic
916473097 1:165142795-165142817 AGAAAGGAAGAGAGGGAGGGAGG - Intergenic
916851022 1:168703702-168703724 GTAAAGGAGGAGAGGGAAGGAGG + Intronic
916890727 1:169109762-169109784 CAAGATGAGGTGGGGGTGGGGGG + Intronic
916991745 1:170251835-170251857 CAAAATGAGGAGGGGGCATGGGG - Intergenic
917075814 1:171203530-171203552 AAACATGAGAGGAGGGAGGGAGG + Intronic
917194528 1:172451260-172451282 CAAAGTGAGTAGAGAGAGAGTGG - Intronic
917213586 1:172655793-172655815 CAAAGTGGAGAGAGGGAGAGAGG - Intergenic
917422597 1:174880584-174880606 AAAAAGGAAGAGAGGCAGGGAGG - Intronic
917475016 1:175362009-175362031 CATAATGACCAGAGGAAGGGAGG - Intronic
917482909 1:175427830-175427852 AAAAAAGAGGGAAGGGAGGGAGG - Intronic
917497731 1:175556631-175556653 CAAGAGGAGGAGAGTCAGGGAGG - Intronic
917518610 1:175729601-175729623 GAAAAGGAAGGGAGGGAGGGAGG - Intronic
917621089 1:176796797-176796819 AAGAAAGAGGAGAGAGAGGGAGG - Intronic
917632558 1:176904457-176904479 CAGCATGGGGAGAGGGAGTGCGG + Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
917834631 1:178931593-178931615 AAAAGAGAGGAGAGGGAGGGAGG + Intergenic
917841105 1:178978829-178978851 CAAAATGCAGAGGGGGATGGAGG + Intergenic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918183924 1:182110749-182110771 CAAGGAGAGGAGAGGAAGGGAGG - Intergenic
918876145 1:190046310-190046332 AGAAAGGAGGAGAGGGAGGGAGG + Intergenic
919153227 1:193726875-193726897 CAACATGAGCAGAAGGAGTGTGG + Intergenic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919742722 1:200990462-200990484 CAAAAGGAGCAGAGGGAAGTGGG + Intronic
919780861 1:201220111-201220133 AAGAAAGAAGAGAGGGAGGGAGG - Intronic
919780870 1:201220150-201220172 TAGAAAGAAGAGAGGGAGGGAGG - Intronic
919972470 1:202590182-202590204 CCCAATGACGAGAGGGAGGCTGG - Exonic
920095886 1:203486635-203486657 CAAGATGAGGAAGGGGAAGGGGG - Intronic
920101499 1:203519801-203519823 CAGAAAGAGGAAAGGGAGAGAGG + Intergenic
920126075 1:203694770-203694792 TAAGAACAGGAGAGGGAGGGTGG + Intronic
920169953 1:204065690-204065712 CAAAGGCAGGTGAGGGAGGGAGG - Intergenic
920364253 1:205439837-205439859 CAAAATGAAGGGAGAGAGGAAGG + Intronic
920565797 1:206971927-206971949 GAAAAGGAAGGGAGGGAGGGAGG - Intergenic
920793199 1:209112359-209112381 TTAAATGAGGAAAGGGAGGAAGG + Intergenic
920916595 1:210262578-210262600 AAAAATGAGGAGAAGGAAGGAGG - Intergenic
921407251 1:214793995-214794017 CCAAAAGAGGAGAGGAAGGCAGG - Intergenic
921585540 1:216942062-216942084 CCAAAAGAGGGGAGGGAGGGAGG - Intronic
921622105 1:217336691-217336713 GAAACGGAGGAGAGGAAGGGAGG - Intergenic
921661411 1:217807248-217807270 CCAAAAGAGGGGAGGGAGGGAGG + Intronic
921730778 1:218575717-218575739 CAAAATGAGGAGGCAGAGGTGGG - Intergenic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
921835266 1:219771979-219772001 CAAAAAGAGGATTGGGAGGCCGG - Intronic
922213258 1:223501191-223501213 GAAAAGGAGGAGGGGGAGGAGGG - Intergenic
922489234 1:226002219-226002241 CTAAATGGTGAGTGGGAGGGGGG + Intergenic
923063056 1:230494732-230494754 GAAAAAGGAGAGAGGGAGGGAGG + Intergenic
923103065 1:230832658-230832680 CAAAATGAGGGGGTGGAGGGAGG + Intergenic
923127577 1:231045977-231045999 GAAAGAGAGAAGAGGGAGGGAGG + Intergenic
923206755 1:231766561-231766583 CTAAATGAGCAGAGGAAGGGTGG + Intronic
923821453 1:237447849-237447871 AAAAAAGAAAAGAGGGAGGGAGG - Intronic
924148088 1:241097846-241097868 TAAAATGAGGAGACTGAGAGAGG - Intronic
924183902 1:241466680-241466702 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
924664429 1:246056253-246056275 TGAAATGAGGAAAGGCAGGGAGG - Intronic
924862800 1:247943270-247943292 CCAAAAGAGGAGAGTGAGGGAGG + Intronic
924871494 1:248051579-248051601 CCAAAAGAGGAGAGTGAGGGAGG + Intronic
924918249 1:248596953-248596975 AAAAAGGAGGAAAGGAAGGGAGG + Intergenic
1063058077 10:2524011-2524033 CAAAGCGAGGAGGGGGAGGAGGG - Intergenic
1063150843 10:3335025-3335047 AGAATTGAGGAGGGGGAGGGGGG - Intergenic
1063201989 10:3792961-3792983 CAAGAGGAGGAGGAGGAGGGAGG + Intergenic
1063235601 10:4112325-4112347 GAAAATGAGGATAAGAAGGGGGG + Intergenic
1063517317 10:6709693-6709715 CAAAATGAGAAGAGAGAGCAGGG + Intergenic
1063517370 10:6710290-6710312 GAAGAGGGGGAGAGGGAGGGAGG + Intergenic
1063602991 10:7498810-7498832 CCAAAAGAGGAGGAGGAGGGAGG + Intergenic
1063701138 10:8386519-8386541 AAAAATGGGGAGAGGGCTGGAGG + Intergenic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1064114825 10:12568514-12568536 AAAGGTGAGGGGAGGGAGGGAGG - Intronic
1064336616 10:14448788-14448810 AGGAAGGAGGAGAGGGAGGGAGG + Intronic
1064389259 10:14927394-14927416 AAAAAAGAAGGGAGGGAGGGAGG + Intronic
1064526297 10:16260339-16260361 AAGAATGAAGAGAGGAAGGGAGG + Intergenic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064666928 10:17662957-17662979 CAAAGTGAAGAGAGAGAGGAGGG - Intronic
1064859957 10:19816208-19816230 CAAAGTGTGGAGAAGGAGCGCGG + Intergenic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1064986339 10:21214368-21214390 AAAAAGGAAGAGAGGGAGGAAGG + Intergenic
1065493232 10:26303486-26303508 GGAAATGAAGGGAGGGAGGGAGG + Exonic
1065629587 10:27664430-27664452 GAAGAGGAGAAGAGGGAGGGAGG + Intergenic
1065732016 10:28718099-28718121 AAGAAAGAAGAGAGGGAGGGAGG - Intergenic
1065966968 10:30778662-30778684 AAGAATGAGGAGTGGGAGGATGG + Intergenic
1066335409 10:34472495-34472517 CAAAATGGGGAGAGGTGGGCAGG + Intronic
1066371560 10:34822117-34822139 GAAAAAGAAGTGAGGGAGGGAGG + Intergenic
1066951422 10:42121830-42121852 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1067415840 10:46101721-46101743 TTAAATGGGGAGAGGGAAGGGGG + Intergenic
1067435909 10:46276999-46277021 TTAAATGGGGAGAGGGAAGGGGG + Intergenic
1067509394 10:46882724-46882746 CAAGATGAGGGGAGGTTGGGAGG + Intergenic
1067978035 10:51048321-51048343 CACAAGGAAGAAAGGGAGGGAGG - Intronic
1069200415 10:65608008-65608030 AAGAAAGAAGAGAGGGAGGGAGG - Intergenic
1069234835 10:66058271-66058293 GAAAATGAAGCGAGGGAGGGAGG - Intronic
1069287303 10:66731425-66731447 CAAAAAGAAGGAAGGGAGGGAGG - Intronic
1069388885 10:67911619-67911641 CAAACGGAAGGGAGGGAGGGAGG - Intronic
1069696198 10:70387272-70387294 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1070358028 10:75659343-75659365 AAAAGAGAGGAAAGGGAGGGAGG - Intronic
1070459310 10:76648845-76648867 CAAAAAGAAGAGAGAGAGAGGGG - Intergenic
1070591407 10:77804479-77804501 AAAAGCGAAGAGAGGGAGGGAGG + Intronic
1070810945 10:79297910-79297932 GAAAACAAGGAGAGGGAGAGGGG + Intronic
1070984906 10:80680285-80680307 CAAAATGAGGAGGGGGCTGTAGG + Intergenic
1071212346 10:83358479-83358501 CAAGATGTGGAGATGGAGGGGGG - Intergenic
1071508775 10:86248361-86248383 CCAAATTGGGAGAGGGAGGGCGG + Intronic
1071591120 10:86874398-86874420 AAAAAAGAGGAGAGGAGGGGAGG - Intronic
1071688734 10:87792459-87792481 CAAAATCAGCAAAGGGAAGGGGG - Intronic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1071795881 10:89005168-89005190 AAAAACGAAGGGAGGGAGGGAGG + Intronic
1071896110 10:90068526-90068548 AAAAAAGAGAAGAGAGAGGGAGG - Intergenic
1072047315 10:91669937-91669959 CAAAAGTGGGAGAGGGAGGGAGG + Intergenic
1072116421 10:92374469-92374491 CAAAAGGAGGGAGGGGAGGGTGG - Intergenic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072800033 10:98386280-98386302 TAGAAGGAAGAGAGGGAGGGAGG + Intronic
1073448218 10:103593416-103593438 CAAAAGCAGGAGAGGGTCGGGGG + Intergenic
1073552249 10:104414453-104414475 CAAAAGGGAAAGAGGGAGGGAGG + Intronic
1073771820 10:106743252-106743274 CAGAATGAGGATAGAAAGGGAGG + Intronic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074087022 10:110215873-110215895 GAAAAAAAAGAGAGGGAGGGAGG + Intronic
1074478638 10:113796990-113797012 GAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1074729697 10:116356369-116356391 GAAGAAGAGGGGAGGGAGGGAGG + Intronic
1074979698 10:118609661-118609683 GAAAAAGAAGGGAGGGAGGGAGG + Intergenic
1075027806 10:118999376-118999398 CACAATGGGGAGAGGGAGAGAGG + Intergenic
1075235434 10:120723290-120723312 AAGAATGAAGGGAGGGAGGGAGG + Intergenic
1075317734 10:121466018-121466040 GCAAAAGAGGGGAGGGAGGGAGG + Intergenic
1075419143 10:122288022-122288044 AAGAAGGAAGAGAGGGAGGGAGG - Intronic
1075762132 10:124864835-124864857 CAACAGGAGGAGAGAGAGGCAGG + Intergenic
1076127747 10:127988672-127988694 CCAAAAGGGAAGAGGGAGGGAGG + Intronic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076563492 10:131382471-131382493 CAGGATGGTGAGAGGGAGGGAGG - Intergenic
1076703598 10:132288154-132288176 AAAAAGGAGAAGAGTGAGGGAGG + Intronic
1076736723 10:132462334-132462356 AAAACTGAGGAGGGGGCGGGTGG + Intergenic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077136674 11:1002993-1003015 AAAAGAGAGGAGAGGGAGGCGGG - Intronic
1077245918 11:1538156-1538178 TAAAAAGAGGAGAAGGAAGGAGG - Intergenic
1077392814 11:2307843-2307865 GAAAGTGAGGTGAGGGAGGTGGG + Intronic
1077619565 11:3708295-3708317 AAAAATGGGGAGGGGGAGAGTGG + Intronic
1077761748 11:5107716-5107738 GAAGAGGAGGAGGGGGAGGGGGG + Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078114477 11:8431920-8431942 CAAAATGACCAGAGGTATGGAGG - Intronic
1078129075 11:8596963-8596985 AGAAAGGAGGGGAGGGAGGGAGG + Intergenic
1078444157 11:11391667-11391689 CAAAATGAGGCTAGGAAGAGGGG + Intronic
1078657962 11:13260033-13260055 AAAACAGAGGAGAAGGAGGGAGG + Intergenic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079324120 11:19476940-19476962 CATGAAGAGGAGAGGGAGAGTGG - Intronic
1079424659 11:20328659-20328681 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1079512603 11:21228754-21228776 AAAAAAGAGGAGAGGAAAGGAGG - Intronic
1079629342 11:22654372-22654394 AAGAAGGAAGAGAGGGAGGGAGG - Intronic
1079736852 11:24008193-24008215 GTAAAAGAGGAGAGGGAGAGGGG + Intergenic
1080108507 11:28538749-28538771 CAATAAGATGACAGGGAGGGAGG - Intergenic
1080303776 11:30814891-30814913 CTAAATGGGAATAGGGAGGGGGG - Intergenic
1080308047 11:30858058-30858080 CAAAAGGAAGAAAAGGAGGGAGG + Intronic
1080763149 11:35272108-35272130 CAAAATGAGAAGAGGTTGGTGGG + Intronic
1080820917 11:35805586-35805608 CAACAGGAAGAAAGGGAGGGAGG - Intronic
1081328615 11:41777139-41777161 GAAAGAGAGGAGAGAGAGGGTGG - Intergenic
1081405948 11:42698068-42698090 AAAAAAGAAGGGAGGGAGGGAGG + Intergenic
1081633951 11:44708265-44708287 CACAGTGAGGAGAGCGTGGGTGG - Intergenic
1081641319 11:44756300-44756322 CAAAAAGGAGGGAGGGAGGGAGG + Intronic
1082058058 11:47836252-47836274 GAAAATAAAAAGAGGGAGGGAGG + Intronic
1082611808 11:55308447-55308469 CAAAATTAGCAGGGGGTGGGGGG + Intergenic
1082849849 11:57754834-57754856 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1082967455 11:58981421-58981443 GGAAATGAGGAGAGGAGGGGAGG - Intronic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1083209421 11:61173771-61173793 CAAAAGGAGGAGAGGACGGGTGG - Intergenic
1083452837 11:62757677-62757699 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1084040788 11:66541583-66541605 CAAAGTGTGTAGAGTGAGGGGGG + Intronic
1084125129 11:67094387-67094409 AAAAAAGAAGGGAGGGAGGGAGG + Intergenic
1084551287 11:69843642-69843664 AAAAATGAGGAGGGGGGTGGGGG + Intergenic
1084560281 11:69901272-69901294 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1084616565 11:70240338-70240360 CAAAATGAGAACTGGGAGGTAGG + Intergenic
1084695035 11:70747969-70747991 AAAAAAGAGGAGAGGGAAGGAGG + Intronic
1084703573 11:70803001-70803023 CAAAAAGTAGAGAGGGAGCGTGG + Intronic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1084876847 11:72139500-72139522 TAAGATGAGGAGTGGGAGTGGGG + Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085059976 11:73436753-73436775 CATTTTGAGGAGAGGCAGGGAGG - Intronic
1085119426 11:73957674-73957696 AAAAATGAGCAGAGAGAGGGTGG + Intronic
1085401394 11:76237938-76237960 AAAAAGAAAGAGAGGGAGGGAGG + Intergenic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1085845621 11:80061316-80061338 GCGAATGTGGAGAGGGAGGGTGG + Intergenic
1086013765 11:82138836-82138858 CAAAAAGAAGAGAGGGAGGGGGG - Intergenic
1086277956 11:85154111-85154133 CCAAAAGAAGAGAGGGAGGGTGG - Intronic
1086427368 11:86699199-86699221 TAAAATGAGTAGGAGGAGGGGGG - Intergenic
1086505663 11:87501385-87501407 CAAAAAGAGGACAAGGTGGGAGG + Intergenic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1086855485 11:91860520-91860542 CAACCTGAGGAGAGGGGAGGGGG - Intergenic
1086967024 11:93039525-93039547 CCAAAAGAGGGGAGGGATGGGGG + Intergenic
1087000004 11:93408414-93408436 CAAAATGAAGAGAGGTATGCTGG + Exonic
1087128368 11:94647845-94647867 CAAGATGAGGCTAGGGAGGCAGG + Intergenic
1087725681 11:101713673-101713695 CTAAATGGGGGGAGTGAGGGAGG + Intronic
1087833515 11:102846239-102846261 GAAGATGAGGAGAGGGGAGGAGG + Intergenic
1088098981 11:106132910-106132932 CAAAATGTGGAAAAGGAAGGTGG + Intergenic
1088196249 11:107277114-107277136 TGAAATGTGGAGAGGGAGGATGG - Intergenic
1088828719 11:113517128-113517150 CAACAAGAAGAGAGGGAGGGAGG + Intergenic
1088850270 11:113698505-113698527 GACAATCAGGAGAGGGAGAGTGG + Intronic
1088974145 11:114799868-114799890 GAAAAGGAAGAAAGGGAGGGAGG - Intergenic
1089723394 11:120450966-120450988 AAAGATGAGGAGATGGAGGAGGG - Intronic
1090944684 11:131419529-131419551 CAGAATGAGGGGAGGCAGTGAGG + Intronic
1090966455 11:131601574-131601596 AAAAAAAAGGAGAGGGAAGGGGG - Intronic
1090976231 11:131682879-131682901 TAAAATGTGCAGAGGGAGTGTGG - Intronic
1091050478 11:132364163-132364185 TATAATGAGGAGAGAGAGAGTGG + Intergenic
1091074391 11:132601504-132601526 CAAGGTGAGGAGAAGGATGGAGG - Intronic
1091434575 12:462333-462355 AAAAGTGAGGAGAGGGAGAAAGG - Intronic
1091608221 12:1976837-1976859 GGAAAGGGGGAGAGGGAGGGAGG + Intronic
1091738933 12:2946144-2946166 CAAAGTGAGGAAAGGGAGGTAGG - Intergenic
1091774718 12:3176973-3176995 CAAAACGAGGAGTGGCTGGGAGG + Intronic
1091858681 12:3759427-3759449 AAAAAGGAAGGGAGGGAGGGAGG + Intronic
1092092316 12:5812951-5812973 AAGAAGGAAGAGAGGGAGGGAGG + Intronic
1092118774 12:6029044-6029066 CAAAATAAAGGGAGGGAGGAAGG + Intronic
1092162549 12:6324059-6324081 AAAACTGAGAAGAGGAAGGGAGG - Intronic
1092867777 12:12779108-12779130 AAAAATTAGGAGAGAGAGGAGGG - Intronic
1093205567 12:16244610-16244632 AAAAATGAAGAGAGGGAGAAGGG + Exonic
1093251499 12:16810275-16810297 CAAAATGAACACAGAGAGGGCGG - Intergenic
1093288379 12:17294676-17294698 CCAAATGAGGGTAGGGAAGGAGG - Intergenic
1093337670 12:17927091-17927113 CCAAAAGATGAGAGGGTGGGAGG + Intergenic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1093952865 12:25183226-25183248 CTAAAAGAGGGGAGGGAGCGGGG + Intronic
1093989371 12:25572807-25572829 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1094439373 12:30457606-30457628 GAAAATCAAGAGAGGGAGGTAGG - Intergenic
1094540982 12:31363047-31363069 AAGACTGAGGAGATGGAGGGAGG + Intergenic
1095653759 12:44645180-44645202 ACAAGTTAGGAGAGGGAGGGAGG + Intronic
1095817573 12:46441254-46441276 AAAAATAAAGAGAGAGAGGGAGG - Intergenic
1096051013 12:48607436-48607458 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
1096235185 12:49921633-49921655 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1096267449 12:50135095-50135117 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1096784589 12:54009771-54009793 AAAAAGGAGGCGAGGGAGGGGGG - Intronic
1097092937 12:56521908-56521930 GGAAAGGGGGAGAGGGAGGGAGG - Exonic
1097650119 12:62287163-62287185 CCAAAAGAGAAGAGGGAGAGAGG + Intronic
1097786471 12:63765502-63765524 CAAAAGCCAGAGAGGGAGGGGGG - Intergenic
1097990104 12:65825053-65825075 CAAAAAGAGAAGAGGGGAGGAGG - Exonic
1098104240 12:67052759-67052781 AAAAATGAAGGGAGGGAGGGAGG + Intergenic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098177291 12:67805978-67806000 GGAAAAGAAGAGAGGGAGGGAGG - Intergenic
1098216392 12:68224691-68224713 GAGAAAGGGGAGAGGGAGGGAGG + Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098346656 12:69512150-69512172 CCAAAAGAGAACAGGGAGGGAGG - Intronic
1098504853 12:71237609-71237631 AAAAAAGAGGAGGAGGAGGGTGG - Intronic
1098752862 12:74317817-74317839 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1099246072 12:80195043-80195065 AAAAAGGGAGAGAGGGAGGGAGG - Intergenic
1099430835 12:82583602-82583624 CAAAAGGAAGAGTGGGAGGTAGG + Intergenic
1099816408 12:87654363-87654385 GAAAATGAGGCCAGGGATGGAGG + Intergenic
1100185382 12:92133374-92133396 GAAAAAGGAGAGAGGGAGGGAGG - Intronic
1100270607 12:93020889-93020911 CCACATGCTGAGAGGGAGGGTGG + Intergenic
1100420219 12:94425062-94425084 GGAAAGGGGGAGAGGGAGGGAGG + Intronic
1100877257 12:98975264-98975286 AAAAAGGAAGGGAGGGAGGGAGG - Intronic
1100886744 12:99079323-99079345 CAAACTGAGGATAGAGAAGGGGG + Intronic
1100914631 12:99405597-99405619 TAAAAGGAAGAGAGGGAGGAAGG + Intronic
1101225266 12:102681932-102681954 AAGAATGAAGGGAGGGAGGGAGG - Intergenic
1102230337 12:111257516-111257538 AAAGAGGAGGAGAAGGAGGGAGG - Intronic
1102599890 12:114021697-114021719 GGAGATGAGGGGAGGGAGGGAGG + Intergenic
1102679908 12:114684394-114684416 CAACATGATCAGAGGGCGGGCGG + Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103020273 12:117528442-117528464 CCAAATGAGGATGGGGAAGGGGG - Intronic
1103569130 12:121832677-121832699 AATAAAGAGGAGAGGGAGAGAGG - Intergenic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1103988661 12:124784019-124784041 CAGAATGGGGACAGGGAAGGAGG - Intronic
1104407091 12:128526869-128526891 CAAAATGAGGCCAGAGAGGCAGG + Intronic
1105002671 12:132701447-132701469 AAAGAAGAGGGGAGGGAGGGGGG - Intronic
1105425445 13:20291024-20291046 CATAAAGAGGAGAGGCAGGGAGG - Intergenic
1105694408 13:22873592-22873614 CAAAAGGAATGGAGGGAGGGAGG - Intergenic
1105892715 13:24693334-24693356 GGGAAGGAGGAGAGGGAGGGAGG - Intronic
1106177413 13:27343010-27343032 CCAAAAGAGAGGAGGGAGGGAGG - Intergenic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106582340 13:31029004-31029026 GAAAAGGAGGAAAGAGAGGGAGG + Intergenic
1106764707 13:32902364-32902386 TAAAATGAGAAGAGGCAGTGGGG - Intergenic
1107115553 13:36742191-36742213 CAAAAGGAGGAGAGTCAGAGGGG - Intergenic
1107115634 13:36742726-36742748 CAAAAGGAAGAGAGTGAAGGGGG - Intergenic
1108586533 13:51874848-51874870 CAAATTGTGGAGGAGGAGGGAGG - Intergenic
1108798291 13:54061077-54061099 AAGAAGGATGAGAGGGAGGGAGG - Intergenic
1109140242 13:58705647-58705669 AAAAAGAAGGAGAGGAAGGGAGG - Intergenic
1109496632 13:63180359-63180381 AAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1109555272 13:63966042-63966064 CAAAACCAAGAGAGGGAGAGAGG + Intergenic
1109582222 13:64355679-64355701 CAATATGAAGAGAGTGTGGGTGG + Intergenic
1109734859 13:66469451-66469473 CAAAAGGAAGGGAGGGAGGGGGG + Intronic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1110290879 13:73805603-73805625 CAGAAGGAAGGGAGGGAGGGAGG + Intronic
1110789000 13:79566868-79566890 GAAAATGGTGAGAGGGAGGAGGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1112038161 13:95517022-95517044 AAAAAGGGAGAGAGGGAGGGAGG - Intronic
1112038178 13:95517099-95517121 AGAAAGGAAGAGAGGGAGGGCGG - Intronic
1112121334 13:96415251-96415273 ACCTATGAGGAGAGGGAGGGAGG + Intronic
1112423587 13:99276136-99276158 CAAGATGGGGAGAGGCAGTGAGG + Intronic
1112506364 13:99978666-99978688 GTCAAAGAGGAGAGGGAGGGAGG + Intergenic
1112669327 13:101616156-101616178 CAAAATTAAGAGGGTGAGGGAGG + Intronic
1112672473 13:101656044-101656066 CAAAACGAGGTGGGGGAGGGGGG + Intronic
1113110144 13:106814205-106814227 CAGAAAGAAAAGAGGGAGGGAGG + Intergenic
1113189194 13:107724543-107724565 TAAAAGGAAGGGAGGGAGGGAGG - Intronic
1113574935 13:111388660-111388682 GACAATGAGGAGAGGGAGGAGGG - Intergenic
1113618007 13:111694745-111694767 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618018 13:111694804-111694826 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623540 13:111780006-111780028 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623551 13:111780065-111780087 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113813780 13:113158222-113158244 GAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1114217928 14:20671281-20671303 AAAAATCAGGAGGGGGATGGGGG - Intergenic
1114241796 14:20874793-20874815 CAAAAGGAGGAAAAGGAGGAGGG + Intergenic
1114741305 14:25100520-25100542 GAAAATGAGGGGTGGGATGGGGG + Intergenic
1114773562 14:25455969-25455991 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1115084159 14:29493211-29493233 AAAAAAGAGAAGAGGGAAGGGGG + Intergenic
1115269621 14:31537403-31537425 CAAAATTAGTAGAGGGAGATGGG + Intronic
1115813321 14:37134113-37134135 CAAAATGGAGAGAGGGAGGTGGG + Intronic
1115878053 14:37882683-37882705 AATAATGAGGAAAGTGAGGGGGG - Intronic
1116593577 14:46810995-46811017 CAAGAAGAGAAGAGGGAGAGGGG + Intergenic
1116898436 14:50339499-50339521 AAGAAGGAAGAGAGGGAGGGAGG + Intronic
1116934427 14:50724540-50724562 GGAAAGGAAGAGAGGGAGGGAGG - Intronic
1117006351 14:51425082-51425104 CAAAAGGAGGAAAGGGCTGGGGG - Intergenic
1117247148 14:53897442-53897464 CAAAATGAGGAGGAGAAGGGAGG + Intergenic
1117257844 14:53998707-53998729 GAAACTGGGCAGAGGGAGGGGGG - Intergenic
1117846863 14:59920480-59920502 CAAGAGAAGGAAAGGGAGGGTGG + Intronic
1118163895 14:63317230-63317252 CAAAATGAGGAAACATAGGGAGG + Intronic
1118166643 14:63342819-63342841 CAAAATCAGGAGAGTCAGTGAGG + Intergenic
1118399266 14:65364488-65364510 CAAAATGAGGCCAGGCACGGTGG - Intergenic
1118667027 14:68081451-68081473 TAAAAGGAGAAGAGTGAGGGCGG + Intronic
1118717374 14:68569868-68569890 AAAAGTGAGGAGAGGCAGGTGGG + Intronic
1118818454 14:69328930-69328952 CAAAGAGAGGAGAGGGTAGGAGG + Intronic
1118965404 14:70578834-70578856 CCAAAAGTGGGGAGGGAGGGGGG - Intergenic
1118975983 14:70677045-70677067 GAAACTGAGGCCAGGGAGGGTGG - Intergenic
1119071101 14:71585132-71585154 AAGAATGAGAAAAGGGAGGGAGG + Intronic
1119083260 14:71716899-71716921 CAAAAAGAAGAGAGGTAGTGAGG - Intronic
1119551343 14:75516169-75516191 CCAAAGGAGGGGAAGGAGGGAGG - Intergenic
1119595417 14:75928548-75928570 CAATCTCAGGGGAGGGAGGGAGG - Intronic
1119969201 14:78950592-78950614 CAAAAAGAAGAAAGAGAGGGAGG + Intronic
1119988100 14:79162868-79162890 AGAAATGAGGATAGGCAGGGTGG - Intronic
1120923116 14:89772844-89772866 GAAAAAGAGGAGAGGAAGGAAGG - Intergenic
1121066212 14:90968299-90968321 CACAATAGGAAGAGGGAGGGAGG - Intronic
1121573312 14:94963693-94963715 CCAGATGAGGAGACGGAGGGAGG + Intergenic
1121618914 14:95332586-95332608 GAAAAAGAAGAAAGGGAGGGCGG - Intergenic
1121843837 14:97156147-97156169 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
1121923521 14:97905849-97905871 CAAATGGAGGAGAGACAGGGAGG - Intergenic
1122118151 14:99537750-99537772 TAAACTGAGGCCAGGGAGGGAGG - Intronic
1122288269 14:100665679-100665701 CAAGAGGAAGAGAGGGAGGGCGG + Intergenic
1122706818 14:103627085-103627107 CCAAATGAGAGGAGGGAGGCAGG - Intronic
1202937462 14_KI270725v1_random:104412-104434 AAAAATGAGGAAAGGAAGGGAGG - Intergenic
1123395758 15:19933455-19933477 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1123975911 15:25554500-25554522 GAAAAAGAGGAAAGAGAGGGTGG - Intergenic
1124029762 15:25999784-25999806 CAAAAAAAGGAGAGAGAGAGAGG - Intergenic
1124044608 15:26137446-26137468 GAAAAGGAGGAGAGGGAGGCAGG - Intergenic
1124455807 15:29841716-29841738 AAAAAGGAGGGGAGGGAGGGAGG - Intronic
1124563478 15:30795445-30795467 CAAATTAAGGTGATGGAGGGTGG - Intergenic
1124721651 15:32115781-32115803 CAAGATGGAGAGAGGAAGGGAGG + Intronic
1124916287 15:33977991-33978013 GAAAAGGAAGAGAGGAAGGGAGG + Intronic
1125206707 15:37161578-37161600 AAAAATGGAGAGAGGGAGGGAGG - Intergenic
1125217218 15:37289319-37289341 CAACAGGAGGGGAGGAAGGGAGG - Intergenic
1125339523 15:38661072-38661094 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1125744774 15:41990717-41990739 GAAGAGGAGGGGAGGGAGGGAGG - Intronic
1126107574 15:45156788-45156810 CAACATGGAGAGAGGGAGGCAGG - Intronic
1126173369 15:45713042-45713064 AAAAAAGAAGGGAGGGAGGGAGG - Intergenic
1126823885 15:52529941-52529963 CACCGTGAGGAGAGTGAGGGCGG - Intergenic
1126839940 15:52708131-52708153 CAAAATGAAGGGAAGGAGGTTGG + Intronic
1126920555 15:53517819-53517841 CAAGAGGAGGGGAGGGAGAGAGG + Intronic
1126939360 15:53749470-53749492 AAGACTGAGGAGAGGGAGAGAGG - Intronic
1127116985 15:55738764-55738786 CAGGAAGAAGAGAGGGAGGGAGG + Intronic
1127234910 15:57038451-57038473 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1127357351 15:58213219-58213241 CAAAATGAGGGGAGAGGGGTGGG - Intronic
1127693203 15:61418126-61418148 CAAGAAGAGGAGAAGGAGAGAGG + Intergenic
1127736159 15:61840837-61840859 CAAAGGAAGGAAAGGGAGGGAGG - Intergenic
1127788612 15:62378611-62378633 AAGAAGGAAGAGAGGGAGGGAGG + Intergenic
1127808902 15:62546134-62546156 CACAGTGTGGAGAGGGAGGTCGG + Intronic
1128116556 15:65110942-65110964 CATCATGTGGAGAGGTAGGGTGG + Intronic
1128328641 15:66741484-66741506 TAAAATGAGGAGGAGGTGGGTGG + Intronic
1128371405 15:67042238-67042260 CTACCTGAGGAGGGGGAGGGGGG + Intergenic
1128557471 15:68641488-68641510 GAAAAGGAGAAGGGGGAGGGTGG + Intronic
1128582639 15:68819931-68819953 AAAGAGGAGGAGAGGAAGGGAGG + Intronic
1128790515 15:70430070-70430092 CAAAATGAGGATGGAGAGGGTGG - Intergenic
1128955400 15:71937030-71937052 AAAAACGAAGGGAGGGAGGGAGG + Intronic
1129141241 15:73599641-73599663 GAAAAGGAAGGGAGGGAGGGAGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1129320244 15:74770760-74770782 CAAAGTGAGGACAGGTAGGAAGG - Intergenic
1129431061 15:75502455-75502477 AAAAAAAAAGAGAGGGAGGGAGG + Intronic
1129521508 15:76189343-76189365 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1129743317 15:78000837-78000859 TAGATTGAAGAGAGGGAGGGAGG - Intronic
1129908388 15:79206100-79206122 CAAAAGGAGGAGAGGGACACTGG + Intergenic
1130190074 15:81725933-81725955 CAAAGTGGGGGCAGGGAGGGAGG - Intergenic
1130241206 15:82193897-82193919 CAGAATGAGGAGAGTGAAGGCGG - Intronic
1130459222 15:84147262-84147284 CAGAATGAGGAGAGTGAAGGCGG + Intergenic
1130560699 15:84955934-84955956 GGAAATGTGGAGAGGGAAGGAGG - Intergenic
1130951729 15:88596217-88596239 GAAGAGGAGGGGAGGGAGGGGGG - Intergenic
1130977981 15:88791963-88791985 CACAATCTGGTGAGGGAGGGAGG + Intergenic
1131316055 15:91338673-91338695 GAGAGTGAGGAGAGAGAGGGAGG + Intergenic
1131318412 15:91362622-91362644 GAAAAAGTGGGGAGGGAGGGGGG + Intergenic
1131825573 15:96320870-96320892 AAAAAGGAAGCGAGGGAGGGAGG - Intergenic
1131971770 15:97900727-97900749 TAAATGCAGGAGAGGGAGGGTGG + Intergenic
1132433396 15:101778255-101778277 CAAATTAAGGTGATGGAGGGTGG + Intergenic
1132484358 16:182595-182617 AAAAAAGAGGAGGGGGCGGGGGG + Intergenic
1132594174 16:740706-740728 GAAACTGAGGCCAGGGAGGGCGG - Intronic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133018510 16:2955732-2955754 CAAAGTCAGGAGGGTGAGGGTGG + Intergenic
1133254057 16:4505602-4505624 CCAAATGAGGTGAGCGATGGGGG + Exonic
1133433136 16:5755922-5755944 CATAATGAAGAGAGGGAAGTAGG + Intergenic
1133568630 16:7019914-7019936 CAAAATGTGGAAAGGCTGGGAGG - Intronic
1133641324 16:7719942-7719964 CTAAAGGAGGAGAGGGAAGGAGG + Intergenic
1133663042 16:7937466-7937488 AAGAAGGAAGAGAGGGAGGGAGG - Intergenic
1133749148 16:8711358-8711380 CAAAGTAAGGAGGGAGAGGGTGG + Intronic
1134288013 16:12879252-12879274 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1134821801 16:17252985-17253007 CTAAATGAGGAGATGGAGACAGG - Intronic
1134840875 16:17400594-17400616 AAAAAGAAAGAGAGGGAGGGAGG + Intronic
1135152757 16:20023790-20023812 CAAATTCAGGAGAGAGAGTGTGG + Intergenic
1135712999 16:24733877-24733899 CAAAAAGAGGTGAGTGAGGCTGG + Intronic
1136079204 16:27840509-27840531 CAAAAGGAGGAGTGGGCAGGAGG + Intronic
1136101230 16:27997840-27997862 AAAAAAGTGGAGAGGGTGGGAGG - Intronic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136178913 16:28537766-28537788 GAAATTGAGGATAGAGAGGGTGG - Intronic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1136589014 16:31206059-31206081 AAAGAGGAGGGGAGGGAGGGAGG - Intergenic
1136654646 16:31702684-31702706 GAGAATGAGGAGAGGCTGGGGGG + Intergenic
1136698205 16:32105609-32105631 GAAAAAGAGGAAAGGGAGGGAGG + Intergenic
1136698696 16:32111949-32111971 AAAAAGGAGGAGGGGGAAGGAGG - Intergenic
1136768908 16:32815880-32815902 AAAAAGGAGGAGGGGGAAGGAGG + Intergenic
1136769401 16:32822240-32822262 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1136798704 16:33048898-33048920 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1136901084 16:34038686-34038708 AAAAAGGAGGAAAGGAAGGGAGG + Intergenic
1136935598 16:34461046-34461068 AGAAATGAAGAGAGGGAGGAGGG - Intergenic
1136935620 16:34461175-34461197 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1136946089 16:34652791-34652813 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1136956417 16:34791845-34791867 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1136964198 16:34887395-34887417 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1136964220 16:34887524-34887546 AGAAATGAAGAGAGGGAGGAGGG + Intergenic
1136968344 16:34942087-34942109 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137088813 16:36162641-36162663 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1137093342 16:36221867-36221889 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1137488893 16:48914250-48914272 CACAGGGAGGAGAGGAAGGGAGG - Intergenic
1137684250 16:50374780-50374802 GAGACTGAGGAGGGGGAGGGAGG + Intergenic
1137744430 16:50810349-50810371 AAAAATGACGAGTGGGAGGAGGG + Intergenic
1137805182 16:51297867-51297889 CAGAATGAGGAGTGGGGTGGAGG + Intergenic
1137849201 16:51721584-51721606 TAAAATGAGGGCAGGGAAGGGGG + Intergenic
1138096621 16:54217066-54217088 CACAATGAGGGGTGGCAGGGTGG - Intergenic
1138323241 16:56137660-56137682 GAAACTGAGAAGAGGGAGCGGGG - Intergenic
1138458522 16:57134560-57134582 CACTATGAGGAGAGGGTGGTTGG + Intronic
1138692089 16:58777581-58777603 CAAAAGGAAGAGAGAGAGGCTGG - Intergenic
1138833113 16:60400173-60400195 CAAAATCAGATGAGGGAGAGAGG - Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139097813 16:63726939-63726961 TAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1139312244 16:66037406-66037428 CCAAGATAGGAGAGGGAGGGGGG + Intergenic
1139337367 16:66242167-66242189 CAGTATGAGGTGTGGGAGGGTGG + Intergenic
1139514980 16:67447483-67447505 CCAAATGAGGGGAGGAATGGTGG - Intronic
1139694864 16:68666666-68666688 CAAAAAGAAGAGAGAGAGAGGGG - Intronic
1140088286 16:71815816-71815838 CAAAAGGAGGAGGGGAGGGGAGG + Intergenic
1140183261 16:72742025-72742047 GAAAAGGAGGAGAGAGAGAGAGG - Intergenic
1140339315 16:74141441-74141463 CAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140468815 16:75203611-75203633 GAAAATGCAGAGAGGGAGGCGGG + Intergenic
1140686473 16:77438306-77438328 TAAGAGGAGCAGAGGGAGGGAGG + Intergenic
1140724446 16:77799368-77799390 GAGAAAGAGGAGAGAGAGGGAGG - Intronic
1140795052 16:78429534-78429556 AAAGATGAGTAGAGAGAGGGAGG + Intronic
1140914581 16:79482859-79482881 GGAGAGGAGGAGAGGGAGGGAGG - Intergenic
1140927927 16:79600555-79600577 CGACTGGAGGAGAGGGAGGGGGG + Exonic
1141067524 16:80926250-80926272 CAAAAGGAGGAGGGGGAGAAGGG + Intergenic
1141665213 16:85462352-85462374 CAAGCTGAGGGTAGGGAGGGTGG - Intergenic
1141773008 16:86102264-86102286 AAAGAGGAAGAGAGGGAGGGAGG - Intergenic
1142024448 16:87804943-87804965 CAGCATGTGGAGAGAGAGGGCGG + Intergenic
1203071325 16_KI270728v1_random:1077991-1078013 AAAAAGGAGGAGGGGGAAGGAGG + Intergenic
1203071817 16_KI270728v1_random:1084345-1084367 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1142570737 17:872183-872205 AGACAAGAGGAGAGGGAGGGAGG + Intronic
1142708091 17:1709093-1709115 CAAAATGAAGAGAGGGCCGGGGG + Intronic
1142950008 17:3471155-3471177 AAAAATGGAGAGAGGGAGGAAGG + Intronic
1143007632 17:3847116-3847138 AAGAAAGAGGAGAGGGAGGAAGG - Intergenic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143181368 17:4986390-4986412 AAGGATGAGGAAAGGGAGGGAGG + Intronic
1143282110 17:5762675-5762697 CACAATGAGGAGAGAGTGGGAGG - Intergenic
1143309277 17:5975173-5975195 CAAACTGAAGAGAGAGAGAGAGG - Intronic
1143377301 17:6474344-6474366 CAGAATGAGGAGAGTGAAGTCGG - Intronic
1143450711 17:7035392-7035414 ATAACTGAGGAGAGGAAGGGCGG - Intergenic
1143453380 17:7050324-7050346 CAGAAGGTGGACAGGGAGGGAGG + Intergenic
1143823187 17:9581536-9581558 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1143947431 17:10605475-10605497 GAGAAGGAGGAGGGGGAGGGAGG + Intergenic
1143965754 17:10755627-10755649 AAAAAGGGAGAGAGGGAGGGAGG - Intergenic
1144396161 17:14845175-14845197 GAAAAGGAAGAGAGGAAGGGAGG + Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1144777661 17:17792900-17792922 AAAAAGGAAGGGAGGGAGGGAGG - Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1145692849 17:26762199-26762221 AAAAAGGAGGAGGGGGAAGGAGG - Intergenic
1145709108 17:26952519-26952541 AAAAATGAGGAAAGGAAGGGAGG + Intergenic
1145944407 17:28762181-28762203 TGAAATGAGGGTAGGGAGGGTGG + Intronic
1145952375 17:28829202-28829224 AAAAAAGAGTAGAGAGAGGGTGG - Intronic
1145960832 17:28885733-28885755 AGAAAAGAGGAGAGGGAGGAAGG + Intronic
1145961114 17:28887005-28887027 GAAATAGGGGAGAGGGAGGGAGG + Intronic
1146090681 17:29874293-29874315 AAAAATGGGGAGGGGGTGGGTGG + Intronic
1146206317 17:30908110-30908132 TAAAATGAGGACAGGAAGGCCGG + Intronic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146434260 17:32828639-32828661 CTACATGCAGAGAGGGAGGGAGG + Intronic
1146471732 17:33130289-33130311 GAAGATGAGGAGGGGGAGGAAGG - Intronic
1146487837 17:33258502-33258524 CTAAATGAAGTGAGGGAGCGAGG + Intronic
1146536457 17:33657014-33657036 AACAATGAGGACAGGGAGGATGG + Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1146584323 17:34069201-34069223 GGAAAGGAAGAGAGGGAGGGAGG - Intronic
1146654089 17:34625184-34625206 CAGAATGGGGGCAGGGAGGGAGG + Intronic
1146671488 17:34741017-34741039 CAAAATGTGGTGAGGGAGGGGGG + Intergenic
1147050145 17:37788243-37788265 CCAAAAGGGGAGAGGGAGGGAGG - Intergenic
1147258534 17:39196043-39196065 CAGAATGGGGAGAGTGAGTGAGG + Intronic
1147311358 17:39597835-39597857 CACAAGGAGGAGAGGAAGGGGGG - Intergenic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147533207 17:41299439-41299461 AAAAAGGAGGAGGGGGAGAGAGG - Intergenic
1147554939 17:41472323-41472345 CAAAATAGGGAGAGAGATGGGGG + Intergenic
1148014207 17:44509597-44509619 CAAAAGAAAGAGAGAGAGGGGGG + Intergenic
1148211707 17:45812807-45812829 AAACAGGCGGAGAGGGAGGGAGG - Intronic
1148495218 17:48049352-48049374 GAAAAAAAGGAGAGGGATGGTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148760322 17:49996612-49996634 CAAAATGGGGTGTGGGAGGCAGG - Intergenic
1148775287 17:50091802-50091824 GAAAGTGAGGAGAGGGAAAGGGG - Intergenic
1148801681 17:50231074-50231096 CAAAAAGAAGGAAGGGAGGGAGG + Intergenic
1148851673 17:50558682-50558704 GAAAATGAGGACAGAGAGGCTGG - Intergenic
1148955115 17:51347308-51347330 AAAAATGATGAGAAGGAGAGAGG - Intergenic
1149017080 17:51920354-51920376 GGAAATGATGAAAGGGAGGGAGG + Intronic
1149301176 17:55305645-55305667 GAAAAAGTGGAGAGGGAGAGGGG - Intronic
1149376982 17:56054005-56054027 GAGAATCAGAAGAGGGAGGGAGG - Intergenic
1149522111 17:57325298-57325320 CAAAAGGAGGAAAGTGGGGGAGG + Intronic
1149586664 17:57792959-57792981 CAAAATGAAAGGAGAGAGGGAGG + Intergenic
1150229668 17:63543263-63543285 GAAACTGAGGAGGGGGAGAGGGG - Intronic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1150784979 17:68154849-68154871 GAAAAAGAAGAAAGGGAGGGAGG - Intergenic
1150822214 17:68444862-68444884 GAGAAGGAAGAGAGGGAGGGAGG - Intronic
1150830421 17:68513108-68513130 CAAAATTGGGAAAGGGAGAGAGG - Intronic
1150843602 17:68632826-68632848 CAAAGTGAGGAGAGAGACTGTGG + Intergenic
1150859460 17:68786362-68786384 GAAAAGGAGGGGAGGGAGAGAGG - Intergenic
1150956153 17:69862644-69862666 CAAAGTGGGGAGTGGGCGGGGGG - Intergenic
1150978091 17:70111340-70111362 CAAAAAGAGGAGATGGAGCTGGG + Intronic
1151000517 17:70370217-70370239 CAAAATGTGGAGAGAAATGGAGG - Intergenic
1151050999 17:70978550-70978572 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151051009 17:70978576-70978598 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151466631 17:74289791-74289813 CAAGTGGAGGAGCGGGAGGGAGG + Intronic
1151523154 17:74645557-74645579 CAAAAAGGGTAGAGGGAGTGAGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152228466 17:79103326-79103348 GAAGAAGAGGAGTGGGAGGGGGG + Intronic
1152648173 17:81479878-81479900 GATAATGAGGAGAGAGGGGGTGG - Intergenic
1152760216 17:82103696-82103718 AAAAGTGAGCTGAGGGAGGGGGG + Intronic
1203183894 17_KI270729v1_random:93410-93432 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1153646138 18:7197707-7197729 CGAGAAGAAGAGAGGGAGGGAGG + Intergenic
1153766156 18:8376738-8376760 CAAAAAGGGGGAAGGGAGGGAGG - Intronic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1154214435 18:12405675-12405697 GAAAAGGAAGAGAGGGAGGGAGG + Intergenic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1154519142 18:15208239-15208261 AAAAAGGAGGAAAGGAAGGGAGG - Intergenic
1155255875 18:23997622-23997644 GAAAAGAAAGAGAGGGAGGGAGG + Intronic
1155535546 18:26812737-26812759 AACAATGAGAAGAGGGAGGTGGG + Intergenic
1155753117 18:29454195-29454217 AAAACTGAGGAGAGGGAAGAAGG + Intergenic
1156109257 18:33703670-33703692 AAAAGTGAGGAGAGGGATGGGGG - Intronic
1156273117 18:35555564-35555586 CAAAATGTGGAGAAGGATGGAGG + Intergenic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1156501958 18:37565865-37565887 GAGAGAGAGGAGAGGGAGGGAGG - Exonic
1156553602 18:38043445-38043467 CTCAAAGGGGAGAGGGAGGGAGG + Intergenic
1156686101 18:39648726-39648748 GAAAAGGATGGGAGGGAGGGAGG - Intergenic
1157195882 18:45619817-45619839 CAAATTGAAGGGAGAGAGGGTGG - Intronic
1157358304 18:46955098-46955120 CAAAAGGAAGGAAGGGAGGGAGG - Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157475549 18:48021246-48021268 AAAAAAGAAGAAAGGGAGGGAGG - Intergenic
1157806714 18:50663864-50663886 CAGAATGAGGTGCGCGAGGGAGG + Exonic
1157858827 18:51123504-51123526 AAAAGAGAGGGGAGGGAGGGAGG - Intergenic
1158030574 18:52959551-52959573 CAAAAAGTGGGGAGGAAGGGAGG - Intronic
1158208518 18:55021165-55021187 GAAAATGTGAAGTGGGAGGGAGG - Intergenic
1158509850 18:58080679-58080701 CTAAATAAGGAGCGAGAGGGTGG + Intronic
1158560096 18:58506211-58506233 CCAAAAGAGGGGAGGGAGGGAGG + Intronic
1158988766 18:62847274-62847296 AGAGATGGGGAGAGGGAGGGAGG + Intronic
1159166146 18:64703273-64703295 CCAAATGGGGAGGGGGAAGGTGG - Intergenic
1159418804 18:68188101-68188123 CAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1159677202 18:71299686-71299708 AAAGAAGGGGAGAGGGAGGGAGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160194106 18:76738911-76738933 CAAAAGGAAGGAAGGGAGGGAGG - Intergenic
1160454590 18:78992012-78992034 CAAAATTTTGAGACGGAGGGCGG + Intronic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160870554 19:1275931-1275953 CAACAGGGAGAGAGGGAGGGAGG - Intronic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1160970696 19:1766554-1766576 CAGAGAGGGGAGAGGGAGGGAGG + Intronic
1161117632 19:2507561-2507583 GAAAAAGAAGAGAGGGAGGGAGG - Intergenic
1161193812 19:2974934-2974956 AAAAAAGAAGGGAGGGAGGGAGG - Intergenic
1161207101 19:3047010-3047032 AAAACTGAGGGGAGGGAGGAGGG - Intronic
1161226155 19:3146909-3146931 CAGAGTGAGGAGGGGGAGAGAGG - Intronic
1161243056 19:3233664-3233686 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161253093 19:3291736-3291758 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161442604 19:4300812-4300834 CAGAGTGAGGACAGGGAGAGAGG + Intronic
1161509558 19:4662976-4662998 TAAAATGAGGACAGGGAGGAGGG - Intronic
1161509729 19:4663680-4663702 TAGAATGAGGACAGGGTGGGTGG - Intronic
1161509762 19:4663819-4663841 CAGAATGAGGATGGGGTGGGTGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161642947 19:5435706-5435728 CAGAGTGAGGAGGGGGAGAGAGG - Intergenic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1162065185 19:8121188-8121210 GGCATTGAGGAGAGGGAGGGTGG - Intronic
1162137005 19:8561584-8561606 AAAAGAGAAGAGAGGGAGGGAGG - Intronic
1162157794 19:8691439-8691461 CAGAAAGGGAAGAGGGAGGGAGG - Intergenic
1162269656 19:9603859-9603881 AAAGAAAAGGAGAGGGAGGGAGG + Intergenic
1162550278 19:11354854-11354876 CAAGCTGTGGAGAGAGAGGGTGG - Exonic
1162986709 19:14275392-14275414 GAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1163505548 19:17703935-17703957 CAAGAGGAGGAGACGGAGGCAGG + Intergenic
1163712022 19:18852634-18852656 AAAGAGGAGGGGAGGGAGGGAGG - Intronic
1163728657 19:18937320-18937342 AAAAAAGAAGGGAGGGAGGGAGG + Intronic
1164479803 19:28602616-28602638 AAACCTGAGGAGTGGGAGGGAGG - Intergenic
1164936275 19:32216994-32217016 AAAGAGGAGGAGAGGTAGGGTGG - Intergenic
1165332412 19:35148105-35148127 AAGAAAGAGGGGAGGGAGGGAGG + Intronic
1165847399 19:38827071-38827093 GGAAGGGAGGAGAGGGAGGGAGG + Intronic
1165847411 19:38827101-38827123 GGAAGGGAGGAGAGGGAGGGAGG + Intronic
1165859240 19:38898553-38898575 AAAATGGAGCAGAGGGAGGGAGG + Intronic
1165897411 19:39151069-39151091 AAAAATGAGGACAGAGAGGTGGG + Intronic
1166142717 19:40813576-40813598 AAAAAGGAAGGGAGGGAGGGAGG - Intronic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1166329338 19:42069520-42069542 CAAATGGAGGGGAAGGAGGGAGG + Intronic
1166876847 19:45902633-45902655 CCGAAAGAGGGGAGGGAGGGAGG - Intergenic
1167127200 19:47557980-47558002 CAAAATGGGCAGGGGGAGTGGGG + Intergenic
1167505770 19:49870282-49870304 CAAGAAGGGGAGAGGGAGAGGGG - Intronic
1167552395 19:50170042-50170064 AGAAATGAAGGGAGGGAGGGAGG - Intergenic
1168072054 19:53958870-53958892 GAAGATGCGGAGAGGGAGCGGGG - Intergenic
1168143914 19:54408574-54408596 AAAAAGGAAGAGAGGGAGGAAGG + Intergenic
1168153620 19:54461639-54461661 AAGAATGCGGAGAGGGAGGGAGG - Exonic
1168257017 19:55172731-55172753 GAAAAAAAAGAGAGGGAGGGAGG + Exonic
1168320723 19:55508006-55508028 GACAGTGAGGAGAGGGAGGCAGG + Intronic
1202672021 1_KI270709v1_random:63959-63981 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1202682368 1_KI270712v1_random:18780-18802 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
924961268 2:36606-36628 AAAAATCAAGAAAGGGAGGGAGG - Intergenic
925079363 2:1051145-1051167 AGAAAGGGGGAGAGGGAGGGAGG - Intronic
925235701 2:2275514-2275536 CAAAACCAGGAGAGGGAAAGTGG + Intronic
925258739 2:2511658-2511680 GAAAAGGAGGAAAGGGAGGTGGG - Intergenic
925306185 2:2849439-2849461 AAAAAGAAGGAGGGGGAGGGGGG - Intergenic
925600000 2:5598555-5598577 CTAAATAAGGAGAGAGAGGTGGG + Intergenic
925659133 2:6183986-6184008 AGAAATGAAGAGAGGGAGGAAGG + Intergenic
925899556 2:8498871-8498893 CAAAATGAGGATGAGGATGGAGG + Intergenic
925923181 2:8651722-8651744 CAAAAAGAGGAGAGGGAGGGAGG + Intergenic
926240506 2:11081222-11081244 GGAAATGGGGGGAGGGAGGGGGG - Intergenic
926460595 2:13125083-13125105 TAAAAGGAAGGGAGGGAGGGAGG + Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
927461457 2:23302107-23302129 CAAAGTGGGGGGGGGGAGGGTGG - Intergenic
927844724 2:26465475-26465497 CAAAACAAGGAGAGGGACAGTGG - Intronic
927877639 2:26669492-26669514 TAAAAGGAAGGGAGGGAGGGAGG - Intergenic
927962944 2:27251859-27251881 GAAATCGAGGAGAGGGAAGGAGG - Intergenic
928218022 2:29378713-29378735 AAAAAGAAAGAGAGGGAGGGAGG - Intronic
928290164 2:30029754-30029776 AGAAAGGAAGAGAGGGAGGGAGG + Intergenic
928317012 2:30254617-30254639 CAAAAGGAGGAGGGGGGGAGGGG - Intronic
928972901 2:37050751-37050773 CAAAATGAGGCGAGGCGCGGTGG + Intronic
929024268 2:37584439-37584461 CAAAAAGAGAAGAGAGAGTGAGG + Intergenic
929103165 2:38337087-38337109 CAAGAAAAAGAGAGGGAGGGAGG + Intronic
929334235 2:40721364-40721386 AAGAAAGAAGAGAGGGAGGGAGG + Intergenic
929561920 2:42961454-42961476 CAAGATGTGGGGAGAGAGGGAGG - Intergenic
929777484 2:44938105-44938127 CAAAACAAGGAGAGAGTGGGAGG + Intergenic
929959619 2:46486725-46486747 GAAAATCAGAAGAGAGAGGGAGG + Intergenic
929960659 2:46493931-46493953 GAAAATGAGGCGGGAGAGGGTGG + Intronic
929993295 2:46807701-46807723 AAGAAAGAAGAGAGGGAGGGAGG + Intergenic
930009188 2:46922723-46922745 CAAAATGTGGGGAGGGGCGGGGG + Intronic
930681639 2:54263231-54263253 CAAGAGGAGGAGAGAGAGGGAGG + Intronic
931011362 2:57918295-57918317 CAGAAGGAGGAGAGGGGGAGTGG + Intronic
931065084 2:58577061-58577083 TAAAATGAGGAGAGAAAGAGAGG - Intergenic
931519824 2:63083586-63083608 CCAAAAGTGGGGAGGGAGGGAGG - Intergenic
931527287 2:63170554-63170576 CAAAATGAGGCCAGGCACGGTGG - Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931919430 2:66997014-66997036 CAAAAATAGGGGAGGGAGTGAGG - Intergenic
931999278 2:67869163-67869185 CACAGTGTGGAGAGGGAAGGAGG - Intergenic
932003435 2:67905546-67905568 TAAAAAGAGGGGAGGGAGAGGGG + Intergenic
932196562 2:69788885-69788907 AAGAAGGAGGAGAGGGAGGGAGG + Intronic
932312589 2:70755701-70755723 TTTTATGAGGAGAGGGAGGGAGG - Intronic
932424438 2:71620172-71620194 CAGATTTTGGAGAGGGAGGGAGG + Intronic
932686710 2:73876598-73876620 CAAGATGAGGATAGGGAGGCTGG + Intergenic
933740853 2:85532800-85532822 AAAGATAAAGAGAGGGAGGGAGG - Intergenic
934173817 2:89561961-89561983 AAAGAAGAAGAGAGGGAGGGAGG - Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934284131 2:91636310-91636332 AAAGAAGAAGAGAGGGAGGGAGG - Intergenic
934303475 2:91799022-91799044 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
934329784 2:92053734-92053756 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
934468001 2:94283640-94283662 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
934511329 2:94946715-94946737 AAAAGTGAGTAGATGGAGGGGGG - Intergenic
934969105 2:98748818-98748840 CAAAACCAGGAGTGGGCGGGTGG - Intergenic
934995374 2:98953096-98953118 AAAGAAGAGGAGAAGGAGGGCGG - Intergenic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935942252 2:108252851-108252873 AAAAAGGAGGAGAAGTAGGGGGG + Intronic
936055200 2:109257357-109257379 TGAAAGAAGGAGAGGGAGGGAGG + Intronic
936259086 2:110942968-110942990 AAAAAAGAAGAGTGGGAGGGAGG + Intronic
936259106 2:110943074-110943096 AGAAAAGAAGAGAGGGAGGGAGG + Intronic
936471096 2:112799305-112799327 CAAACTGATGGGAGGGAGGGTGG + Intergenic
936999074 2:118446706-118446728 CAAAAGGAAGGGAGGGAGGGAGG - Intergenic
937261357 2:120588435-120588457 CATAAGGAGGCCAGGGAGGGGGG + Intergenic
937369488 2:121287384-121287406 CAATCTGTGGAGATGGAGGGAGG + Intergenic
937419259 2:121740851-121740873 CAAAAGGAAGAAAGGGAAGGAGG - Intronic
937701449 2:124867113-124867135 ATAAATGATGAAAGGGAGGGAGG - Intronic
937713999 2:125011045-125011067 AAGAAGGAAGAGAGGGAGGGAGG + Intergenic
937754668 2:125522265-125522287 CAAAAAGGTGGGAGGGAGGGAGG + Intergenic
937778110 2:125805351-125805373 AAAAATGAAGGGAGGGAGAGAGG + Intergenic
938235618 2:129704166-129704188 CCAGAAGAGGAGAAGGAGGGAGG - Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
938584108 2:132671550-132671572 AAGAAGGGGGAGAGGGAGGGAGG - Intronic
938775425 2:134537443-134537465 CATGATGAGAAGAGGGAGAGAGG - Intronic
938828160 2:135027409-135027431 GAAAAGGATGGGAGGGAGGGAGG + Intronic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939314109 2:140524790-140524812 CCAAAAGGGGAGAGGGAGGAAGG + Intronic
939623484 2:144448646-144448668 CAAAATCTGGAGAGGGGGCGTGG + Intronic
939756493 2:146118928-146118950 AAAAATGAAGGGAGGGAGGAAGG + Intergenic
939966950 2:148619636-148619658 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
940774133 2:157869025-157869047 CCAAAGGATGAGAGGGAGGTGGG - Intronic
941247367 2:163116198-163116220 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
941279559 2:163533235-163533257 AAATAAGAGGAGAGGGAGGGAGG + Intergenic
941329936 2:164167727-164167749 CAAAATGCTGGGAGGCAGGGAGG - Intergenic
941489699 2:166127613-166127635 GAAGAGGAGGAGAGGGAGGAGGG + Intronic
941520230 2:166533218-166533240 AACACTGAGCAGAGGGAGGGAGG - Intergenic
941857623 2:170246852-170246874 GACAATGCGGGGAGGGAGGGAGG + Intronic
941937278 2:170994271-170994293 CAAAATGGGATGAGGGTGGGAGG - Intronic
942202805 2:173589126-173589148 CATGATGAGGACAGGCAGGGTGG - Intergenic
942211773 2:173678299-173678321 AAGGAGGAGGAGAGGGAGGGAGG + Intergenic
942340011 2:174933977-174933999 GAAAATTAGGAGAGGGAGTAAGG + Intronic
942389336 2:175476009-175476031 CAAAATGAGGCGGGGTATGGTGG + Intergenic
942492254 2:176501159-176501181 AAAAAAGCAGAGAGGGAGGGCGG - Intergenic
942787863 2:179720544-179720566 CAAGGGGAGGAGAGGGAGGGAGG + Intronic
942834292 2:180275234-180275256 TAAAAGGAAGACAGGGAGGGTGG - Intergenic
942865935 2:180675054-180675076 AACAAAGAGGAGAGAGAGGGAGG + Intergenic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943821834 2:192333293-192333315 GAAAAGGAAGAGAGGGAGGGAGG - Intergenic
943912217 2:193583723-193583745 AATACTGAGGAGTGGGAGGGAGG + Intergenic
944434189 2:199669427-199669449 TAAAATGAGGAGAGGCGGGAGGG - Intergenic
944777561 2:202982563-202982585 CAAAATTATGAGAGAGAAGGAGG + Intronic
944986001 2:205177905-205177927 CAAACTGAGGACAGGGAGACAGG - Intronic
945189037 2:207166955-207166977 CAGAAGGAGGCGCGGGAGGGAGG - Intronic
945256514 2:207807754-207807776 CACACTCAGGAAAGGGAGGGCGG + Intergenic
945574280 2:211510307-211510329 CTAAAAGAGGAGAGGGTGGGAGG + Intronic
946178128 2:217934341-217934363 CCTAAGGAGGACAGGGAGGGAGG + Intronic
946367513 2:219258276-219258298 CAAAATGAGGCCAGGTATGGTGG - Intronic
946610989 2:221457759-221457781 AGAAAAGAAGAGAGGGAGGGAGG + Intronic
946687975 2:222290932-222290954 AAAAAAGAGGAGAAGAAGGGGGG + Intronic
946805190 2:223464320-223464342 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
946902187 2:224383437-224383459 AGAAAGGAGGGGAGGGAGGGCGG - Intronic
947006067 2:225512791-225512813 GAAAAGAAAGAGAGGGAGGGAGG - Intronic
947131127 2:226925962-226925984 GAAGAGGAGGAGAGGGAGGGAGG + Intronic
947353030 2:229266253-229266275 AAAAATGGGGAGAAGGAGGGAGG - Intronic
947429444 2:230013233-230013255 GAAAATGAGATGGGGGAGGGAGG - Intergenic
947536385 2:230942627-230942649 CCAAAAGAGCAGAGGGAGGGTGG + Intronic
947695894 2:232188142-232188164 AAAAAAGTGGAGGGGGAGGGAGG + Intronic
948027604 2:234790360-234790382 GAAGGTGAGGAGAGGGAGGAAGG + Intergenic
948257094 2:236576435-236576457 GAAAGTGGAGAGAGGGAGGGAGG - Intronic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
948989490 2:241545618-241545640 CAGAAGGAGGACAGAGAGGGAGG + Intergenic
1168755270 20:312387-312409 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1168806012 20:672764-672786 GAAGATGAGGAGAGGGAGGGAGG - Intronic
1168911208 20:1448594-1448616 AAAAATTAGGTGAGGCAGGGTGG + Intronic
1169009428 20:2237978-2238000 CAAGAGGAAGGGAGGGAGGGAGG - Intergenic
1169204951 20:3734167-3734189 CAAAAAAAGGAGCGGGAGTGGGG + Intronic
1169547517 20:6665711-6665733 AAAAATGAAGGGAGGAAGGGAGG - Intergenic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1170126091 20:12965699-12965721 TGAAGTGAGGGGAGGGAGGGTGG + Intergenic
1170660310 20:18332898-18332920 CAAAAGGGAGAGACGGAGGGTGG + Intergenic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1170810482 20:19670191-19670213 CACACTGAGGAGAGGGGGTGGGG + Intronic
1170848666 20:19983823-19983845 CAACATGAGGTTAGGGTGGGAGG - Intronic
1170945961 20:20891180-20891202 TGAAGTGAGGAGAGGAAGGGTGG - Intergenic
1171151974 20:22835200-22835222 CAAAAGGAAGAAAGGGAGAGAGG - Intergenic
1171369806 20:24654608-24654630 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172021097 20:31914660-31914682 AAGAAAGAAGAGAGGGAGGGAGG + Intronic
1172051794 20:32123152-32123174 GACCATGAGGAGAGGGAGAGGGG + Intronic
1172292161 20:33784201-33784223 GGAGATGGGGAGAGGGAGGGAGG - Intronic
1172442609 20:34976741-34976763 CAGAAAGAGGATGGGGAGGGAGG + Intronic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172773157 20:37393100-37393122 GAAAGTGAGGAGAAGGAGTGGGG - Intronic
1172840309 20:37898965-37898987 CTCAAGGAGGGGAGGGAGGGTGG + Intergenic
1172926977 20:38546755-38546777 GAACATGAGGAGTGAGAGGGAGG - Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173002014 20:39111560-39111582 GAAGAGGAGGAGAGGGAGGAGGG + Intergenic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1174068732 20:47885181-47885203 CAAAATGAGGAGAGGAAATAAGG - Intergenic
1174185718 20:48704556-48704578 AAAAAAAAAGAGAGGGAGGGAGG - Intronic
1174758371 20:53182144-53182166 GAAAAGGAAGAGAGGGAGGGAGG - Intronic
1174872852 20:54199589-54199611 CAAAACAAGGTCAGGGAGGGAGG + Intergenic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175326667 20:58134171-58134193 GAAAATGAGAAGAGTGATGGAGG - Intergenic
1175927332 20:62477330-62477352 CAAAAGGAAGGAAGGGAGGGAGG - Intergenic
1176184595 20:63771381-63771403 CAGAAGGAGGGGAGGGAGAGAGG + Intronic
1176289869 21:5038099-5038121 CAGCATGGGGAGTGGGAGGGGGG - Intronic
1176362063 21:6006180-6006202 CAAAAGGAGGAGGAGGAGGGGGG + Intergenic
1176585869 21:8584688-8584710 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1176742570 21:10617412-10617434 AAAAAGGAGGAAAGGAAGGGAGG + Intergenic
1176932134 21:14826422-14826444 GGAAATGAGGGAAGGGAGGGTGG - Intergenic
1177463018 21:21437562-21437584 CAAAATGGGGAGATGAAGTGGGG - Intronic
1177788993 21:25701436-25701458 AAGAAAGAAGAGAGGGAGGGAGG - Intronic
1178693818 21:34775478-34775500 CAAAAAGAGGCCAGGGAGGAGGG + Intergenic
1179115952 21:38492691-38492713 GAAAATGAAGAGTGGGAGAGTGG + Intronic
1179189651 21:39112823-39112845 GAAAAGGAGGAGAAGGAGGATGG + Intergenic
1179302518 21:40125059-40125081 CAAAATGACTAGGGTGAGGGAGG - Intronic
1179343787 21:40537261-40537283 CAATATGTGGTGAGGAAGGGAGG + Intronic
1179409729 21:41153487-41153509 AAAGAGGAAGAGAGGGAGGGAGG + Intergenic
1179669796 21:42938656-42938678 CTATCTGAGGAAAGGGAGGGGGG + Intergenic
1179761455 21:43532365-43532387 CAAAAGGAGGAGGAGGAGGGGGG - Intronic
1179867382 21:44225540-44225562 CAGCATGGGGAGTGGGAGGGGGG + Intronic
1180059034 21:45375306-45375328 CAGGATGTGGGGAGGGAGGGAGG + Intergenic
1180268676 22:10561593-10561615 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1181094584 22:20496477-20496499 GGAGAAGAGGAGAGGGAGGGAGG - Intronic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181469540 22:23129242-23129264 GACAATGAGCAGAGGGAGGAAGG - Intronic
1181524587 22:23472988-23473010 CAGAAAGAGTAGAGCGAGGGTGG + Intergenic
1181828386 22:25538441-25538463 CAAAAAGTGGGGAGGGAGGTAGG + Intergenic
1181844722 22:25698063-25698085 GGAAAAAAGGAGAGGGAGGGAGG + Intronic
1181907367 22:26209956-26209978 AAAAAGGGAGAGAGGGAGGGAGG + Intronic
1181998592 22:26902679-26902701 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1182010766 22:26999025-26999047 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1182490649 22:30669288-30669310 AAAAATGAGGACAGGCATGGTGG + Intergenic
1182589155 22:31365494-31365516 GAAAGGGAGGAAAGGGAGGGAGG + Intergenic
1182705965 22:32280562-32280584 CATAGGGAAGAGAGGGAGGGAGG - Intergenic
1182727086 22:32456451-32456473 ATAAATGAGGGAAGGGAGGGAGG - Intronic
1182765346 22:32754139-32754161 AAAAAGGAAGGGAGGGAGGGAGG - Intronic
1183059328 22:35326638-35326660 CACTAGGAGGAGAGAGAGGGTGG + Intronic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1183294784 22:37023054-37023076 GATAGAGAGGAGAGGGAGGGAGG + Exonic
1183368154 22:37417959-37417981 GAAGGGGAGGAGAGGGAGGGGGG + Intronic
1183589977 22:38774386-38774408 CCAAAGCAGGAGAGGCAGGGCGG - Intronic
1183616249 22:38947594-38947616 GAAAGTGAGTAGAGAGAGGGGGG - Intergenic
1183642861 22:39102628-39102650 CCAAAAGAAGAGAGGGTGGGAGG - Intronic
1183881477 22:40835065-40835087 AAAAATTAGGAGAAGGCGGGGGG - Intronic
1184264463 22:43339706-43339728 TAGAATGAGGAGAGTGGGGGAGG - Intronic
1184264489 22:43339800-43339822 TAGAATGAGGAGAGTGGGGGAGG - Intronic
1184614173 22:45626593-45626615 TAAAGTGAGACGAGGGAGGGAGG + Intergenic
1184763087 22:46556350-46556372 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1184917172 22:47577728-47577750 CAAAAACAGGAAAGGGAGGGAGG + Intergenic
1185101849 22:48844790-48844812 CAGAAGGAGGACAGAGAGGGAGG - Intronic
1203237729 22_KI270732v1_random:21997-22019 TAAAAGGAGGAAAGGAAGGGAGG + Intergenic
1203290062 22_KI270735v1_random:28033-28055 AAAAATAAGGAAAGGAAGGGAGG - Intergenic
1203322949 22_KI270737v1_random:86271-86293 GGAAATGAGGGAAGGGAGGGAGG - Intergenic
949218801 3:1604572-1604594 TAAAAGGTGGAGAGGGAGAGAGG + Intergenic
949263305 3:2127388-2127410 CAAATTAAGTGGAGGGAGGGAGG + Intronic
949486984 3:4549485-4549507 AAAAAGGAAGAGAGGGAGGGAGG - Intronic
950404108 3:12793980-12794002 AAAAAGGAGGGGAGGAAGGGAGG - Intergenic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950712908 3:14826282-14826304 GAAGAAGAGGAGAGGGAGAGAGG - Intronic
950723778 3:14902655-14902677 CAAAATGAGGAGGGGCAGGGAGG - Intronic
950742887 3:15064110-15064132 CAAAATGAGGCGTGGGGGCGGGG - Intronic
950788367 3:15453792-15453814 AAGAAGGGGGAGAGGGAGGGAGG + Intronic
951120229 3:18917973-18917995 CACAATGTGAGGAGGGAGGGAGG + Intergenic
951652038 3:24961611-24961633 CACACTGTGGGGAGGGAGGGCGG + Intergenic
952389447 3:32867172-32867194 AAAAAAGAGGAGGGGGAGGGGGG - Intronic
952480768 3:33759558-33759580 CACAATGAATAGAGGTAGGGAGG + Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952946865 3:38483834-38483856 TAAAAGGAGGGGAGGGAGGGAGG - Exonic
953305134 3:41821971-41821993 CAAAATTAGGAGAGAGAAGTGGG - Intronic
953625447 3:44567185-44567207 GAAAAGAAAGAGAGGGAGGGAGG + Intronic
953855565 3:46497168-46497190 CAAGAGGAGGAGAGGAAGGAAGG - Intergenic
953867070 3:46593370-46593392 TAAAAGGAAGAGAGGGAGAGAGG + Intronic
953873248 3:46646116-46646138 CAATCTGGGGGGAGGGAGGGAGG - Intergenic
954005317 3:47585968-47585990 AAAAATGAGGGGAGGGAGTTTGG - Exonic
954117713 3:48476397-48476419 CAAAATAAGGAGAGGAGGAGGGG + Intronic
954167835 3:48774832-48774854 AGAAAGGAAGAGAGGGAGGGAGG - Intronic
954169548 3:48789836-48789858 CAAAAGGAAGGGAGGGAGAGAGG - Intronic
954346513 3:50004310-50004332 CAATAAGAGGAGAGGGGAGGGGG - Intronic
954428396 3:50455895-50455917 CAGAACGAGGAGAGGAATGGGGG - Intronic
954616049 3:51969081-51969103 CAGAAGGAGGAGTGGGTGGGAGG + Exonic
954735995 3:52706739-52706761 CAAACTGAGGGTTGGGAGGGAGG - Intronic
954748292 3:52799346-52799368 GAAAGTGGGGAGAGGGACGGAGG - Intronic
955498022 3:59556512-59556534 TAAAAATAGGAGAGGGAGGAGGG + Intergenic
955499569 3:59570516-59570538 AAGAATGAGGAGCGTGAGGGAGG - Intergenic
955617670 3:60826119-60826141 AGAAAGGAGGAAAGGGAGGGAGG + Intronic
955747625 3:62155796-62155818 GAAAATGAGAAGAGGAAGGAAGG + Intronic
956137271 3:66111524-66111546 AAAAATGAAGAAAGGAAGGGAGG - Intergenic
956198802 3:66683937-66683959 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
956518032 3:70072116-70072138 AAAAACGAGGAGCGGGTGGGAGG - Intergenic
956555874 3:70521785-70521807 AAAAATGAGGAGACAGAGGGTGG - Intergenic
956618637 3:71198409-71198431 CAAGATGGGGGGAGGGAGGGGGG + Intronic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956846541 3:73188842-73188864 AAAGAAGAGGAGAGGGAGAGGGG - Intergenic
956899935 3:73704753-73704775 CAAAAGGAGGGGAGGCGGGGAGG + Intergenic
957023597 3:75152794-75152816 CCAAAAGTGGAGAGTGAGGGAGG - Intergenic
957047343 3:75386214-75386236 GAAAACGGAGAGAGGGAGGGAGG + Intergenic
957284915 3:78205498-78205520 CAAAAGGAAGAGAGAGAGAGAGG - Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
958005242 3:87802098-87802120 GAAAAGGAAGGGAGGGAGGGAGG - Intergenic
958070164 3:88599664-88599686 GAAAGAGAGGGGAGGGAGGGAGG - Intergenic
958163232 3:89845540-89845562 AAAAATGGTGAAAGGGAGGGAGG + Intergenic
958781467 3:98548481-98548503 CAAAGAAAGGGGAGGGAGGGAGG + Intronic
958852887 3:99350070-99350092 CAAAAGGAAGAGAGAGAAGGGGG - Intergenic
959057322 3:101581100-101581122 CAAACAGAGCAGAGTGAGGGTGG - Intronic
959416284 3:106079129-106079151 CAAGAAGAAGGGAGGGAGGGAGG - Intergenic
959526382 3:107381904-107381926 GAAGGTGAGGACAGGGAGGGTGG - Intergenic
960114166 3:113876869-113876891 AAAAAAGAGGAGGGGTAGGGAGG + Intronic
960447049 3:117762049-117762071 CATAATGAGGAAAGGGAGATAGG - Intergenic
960529920 3:118753007-118753029 GAAAATGAGGAGAAGGAGAAAGG + Intergenic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
961320189 3:126067913-126067935 CTAAATGGGGACAGGGAGCGGGG - Intronic
961556905 3:127702100-127702122 CACACTGAGGAGATGGAGCGGGG + Intronic
961760595 3:129164414-129164436 AAAAATGGAGGGAGGGAGGGAGG + Intergenic
961841282 3:129715098-129715120 AAAAAGGAAGAGTGGGAGGGTGG - Intronic
961865936 3:129953523-129953545 GAAAAAGAAGGGAGGGAGGGAGG - Intergenic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
962064003 3:131960113-131960135 GAAAGAGTGGAGAGGGAGGGAGG + Intronic
962256414 3:133872918-133872940 CAAAAGAAGGTGAGGGAGGGAGG + Intronic
962559519 3:136591226-136591248 AAAAAAGAAGGGAGGGAGGGAGG + Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963108401 3:141665575-141665597 GGAAAGGAGGGGAGGGAGGGAGG + Intergenic
963158794 3:142128684-142128706 AAAAAGAAAGAGAGGGAGGGAGG + Intronic
963235288 3:142949805-142949827 CAAAAAGAAGAAAGGGAGAGGGG - Intronic
963285966 3:143434925-143434947 TAAAATGAGCAGCGGCAGGGAGG - Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963521069 3:146360574-146360596 GAAAAGAAGGAGAGAGAGGGAGG - Intergenic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
963893880 3:150664970-150664992 CTAAGTGGGGAGAGGAAGGGAGG + Intronic
964649804 3:158997755-158997777 CGAAAAGAGAAGAGGGAAGGGGG + Intronic
964839744 3:160980769-160980791 AAAGAAAAGGAGAGGGAGGGAGG + Intronic
965138686 3:164807538-164807560 GAAAAGGAAGGGAGGGAGGGAGG + Intergenic
965386469 3:168051986-168052008 GAAGAGGAGGAGAGGGAGAGAGG + Intronic
965659763 3:171028991-171029013 AAAAAAGGGGAGAGGGAGGGCGG - Intergenic
965661084 3:171042542-171042564 TAAAATGAGGTGGGGCAGGGGGG - Intergenic
965759726 3:172062770-172062792 CAAAATGAGAAGAGGATGGATGG - Intronic
966444545 3:179987225-179987247 GGAAATGAAGGGAGGGAGGGAGG - Intronic
966444571 3:179987313-179987335 TTAAATGGGGAGAGGGAGAGAGG - Intronic
966494678 3:180566548-180566570 TAAAATGAGGGGAGGGAGCCAGG - Intergenic
966833507 3:184031178-184031200 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
967135859 3:186512107-186512129 CCAGATGAAGAGAGGGAGAGAGG + Intergenic
967239506 3:187423745-187423767 CCAAAAGGGGAGAGGGAGTGAGG + Intergenic
967328293 3:188264562-188264584 TAAAATGAGGTAGGGGAGGGAGG + Intronic
967459940 3:189734155-189734177 AAAAAAGAAGGGAGGGAGGGAGG - Intronic
967683384 3:192391909-192391931 CAGATTGAGGAGTGGGAGAGAGG + Intronic
967853393 3:194098624-194098646 AAGAAAGAGGAGAGGAAGGGAGG + Intergenic
967899978 3:194440050-194440072 CAAAATGTGGGTAGGGAGGGAGG + Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968095219 3:195925151-195925173 CCAAAAGATGAGAGGGTGGGAGG - Intergenic
968446888 4:656710-656732 CCAAATGCAGAGAGGGAGAGAGG + Intronic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
968937099 4:3617217-3617239 AGAAAAGAAGAGAGGGAGGGAGG - Intergenic
968937267 4:3617687-3617709 AAAAAGGAAGATAGGGAGGGGGG - Intergenic
969031270 4:4216731-4216753 CAAGATGAGGCGAGGCAGCGTGG + Intronic
969043070 4:4316231-4316253 CCAGATGGGAAGAGGGAGGGTGG + Intronic
969161367 4:5262067-5262089 AAAGATGAGGGGAAGGAGGGAGG - Intronic
969229015 4:5816769-5816791 CAAAATGAGGAGAGAGCCAGAGG - Intronic
969668611 4:8576563-8576585 CAAAAAGGAGAGAGGGAGAGAGG - Intronic
969827670 4:9770777-9770799 AAGAAAGAAGAGAGGGAGGGAGG - Intergenic
969908394 4:10419548-10419570 CAGAAGGAAGAGAGTGAGGGGGG - Intergenic
970237885 4:13976907-13976929 CAAGATATGGGGAGGGAGGGAGG - Intergenic
970344963 4:15144374-15144396 AAAAAAGAGAAGAGGGAGAGAGG - Intergenic
970359266 4:15291987-15292009 AAAAAAGAAGCGAGGGAGGGAGG + Intergenic
970488198 4:16545217-16545239 CAGAAGGAAGGGAGGGAGGGGGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
970572068 4:17393009-17393031 GAAAAGGAAGGGAGGGAGGGAGG + Intergenic
970771742 4:19621472-19621494 AAAACTGAAGAGTGGGAGGGGGG + Intergenic
970888825 4:21018704-21018726 AAAAATGAGGAGAGAAAGAGTGG - Intronic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
971717189 4:30193675-30193697 AGAAAGGAAGAGAGGGAGGGAGG - Intergenic
971784438 4:31082765-31082787 GAAACTCAGAAGAGGGAGGGTGG + Intronic
971861166 4:32108072-32108094 CAAAAGAAAGAGAGAGAGGGAGG + Intergenic
971897290 4:32614281-32614303 GAAACTGATAAGAGGGAGGGAGG - Intergenic
972055558 4:34797433-34797455 GAAAAAGAAGGGAGGGAGGGAGG - Intergenic
972415787 4:38839109-38839131 CAAAGGGAGGGGAGGAAGGGAGG + Intronic
972598931 4:40554765-40554787 AAAAAGGAAGAAAGGGAGGGAGG - Intronic
972633987 4:40866484-40866506 CAAAGTGAGGAGGAAGAGGGAGG - Intronic
972680234 4:41299156-41299178 CCAAAAGAGGGAAGGGAGGGAGG - Intergenic
973170278 4:47134048-47134070 CAAAATGATTAGAGGGAGACTGG + Intronic
973311977 4:48719753-48719775 CAAAATCAGGAAATAGAGGGTGG - Intronic
973331136 4:48911053-48911075 AAAAAGGAAGTGAGGGAGGGAGG - Intergenic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
974029509 4:56763523-56763545 AGAAAAGAGGAGAGGGAGGGAGG - Intergenic
974539064 4:63209589-63209611 AAAAATGAGGAGATGGGAGGAGG + Intergenic
975536921 4:75460703-75460725 CGGAAAGTGGAGAGGGAGGGAGG + Intergenic
975767825 4:77687602-77687624 AAGAATGAGGAGAGGAAGGAAGG + Intergenic
975870018 4:78769633-78769655 AAAAAAAAGAAGAGGGAGGGCGG + Intergenic
975962178 4:79924139-79924161 CCAAAAGAAGAGAGGGAGAGAGG - Intronic
976233037 4:82866096-82866118 GAAAAAGAAGGGAGGGAGGGAGG + Intronic
976546786 4:86344654-86344676 GAATATGAGGGGAGGGAGGAAGG + Intronic
977145308 4:93432586-93432608 CAAAATGGAGTGAGGGAGGGAGG + Intronic
977428797 4:96904561-96904583 CTAAACATGGAGAGGGAGGGAGG + Intergenic
977666977 4:99653632-99653654 GAAAAGGAGGAGGGGGAGGAGGG - Exonic
977997952 4:103517595-103517617 AGAAGGGAGGAGAGGGAGGGAGG - Intergenic
978010970 4:103683857-103683879 AGAAATGAGGAGAGAGAGAGAGG + Intronic
978385066 4:108169879-108169901 CAAAGCCAGAAGAGGGAGGGAGG + Intergenic
978855884 4:113394353-113394375 AGGAAGGAGGAGAGGGAGGGAGG - Intergenic
978967309 4:114756486-114756508 AGGAATGAGGAAAGGGAGGGAGG - Intergenic
979089400 4:116462191-116462213 CATTATGAGAAGAGGAAGGGAGG - Intergenic
979739591 4:124132647-124132669 AAGAAAGAAGAGAGGGAGGGAGG - Intergenic
979768164 4:124488479-124488501 CGGAAGGAGGGGAGGGAGGGAGG + Intergenic
979831557 4:125311673-125311695 AAAAAAAAGGAGAGGGAGAGAGG + Intergenic
980038687 4:127914283-127914305 TAAAATATGGGGAGGGAGGGAGG - Intergenic
980086244 4:128393209-128393231 CTAAGTGGGGAGGGGGAGGGAGG + Intergenic
980213052 4:129814407-129814429 GAAAAGAAAGAGAGGGAGGGAGG + Intergenic
980627392 4:135391083-135391105 CAAGAGGAAGAGAGTGAGGGGGG + Intergenic
981619344 4:146676399-146676421 GAGAAGGAGGAGAGGGTGGGGGG - Intergenic
981784846 4:148465582-148465604 CAAAAAGAGGAGAGGGGAAGAGG + Intergenic
982078321 4:151761159-151761181 GAAATAGAGGAGAGGGTGGGAGG + Intergenic
982183951 4:152777690-152777712 AAAAAGGAAGAGAGGGAGAGAGG + Intronic
982711296 4:158760954-158760976 CAAAAAGAGAAGGGGGAGTGGGG - Intergenic
982948419 4:161657590-161657612 TAGAATGCTGAGAGGGAGGGAGG - Intronic
984014600 4:174410786-174410808 AAGAAGGAAGAGAGGGAGGGAGG + Intergenic
984202434 4:176742081-176742103 CAAAATGGGGGGAAAGAGGGAGG - Intronic
984509564 4:180662111-180662133 TAAAATGAGGACAGGGAGGCAGG - Intergenic
984720820 4:182970950-182970972 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
985282878 4:188304444-188304466 CCAAAAGAGGAGAGAGAGGAAGG - Intergenic
985336973 4:188906171-188906193 AAAAAGGAAGAAAGGGAGGGAGG - Intergenic
985781582 5:1874445-1874467 GAGAAAGAGGAGAGGGAGAGAGG + Intergenic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
986145199 5:5071453-5071475 AAAATTCTGGAGAGGGAGGGAGG - Intergenic
986632011 5:9782906-9782928 CAGAATGAGGATAGCTAGGGAGG + Intergenic
986796511 5:11217986-11218008 AGAAATGAAGGGAGGGAGGGAGG - Intronic
986879031 5:12147554-12147576 AAAAAAGAAGAAAGGGAGGGAGG - Intergenic
987132236 5:14871168-14871190 ATAATTGAGGGGAGGGAGGGAGG + Intronic
987353385 5:17041298-17041320 CAAAAGGAGGAGACAGAGAGGGG - Intergenic
987729872 5:21755502-21755524 TAAATTGAGGAGAGAGATGGAGG + Intronic
988195041 5:27993967-27993989 CAAAATGAAGCCAGGGAGGATGG + Intergenic
988488236 5:31685168-31685190 CAAAATTAGGAAAGAGAAGGGGG - Intronic
989231845 5:39095836-39095858 CACACTGGGGTGAGGGAGGGAGG + Intergenic
989265153 5:39464762-39464784 CAACATGAGGAAAGGCAGGAAGG - Intergenic
989440985 5:41471990-41472012 AAAAAGGAAGAAAGGGAGGGAGG - Intronic
989697715 5:44223153-44223175 AGAAATGAGGGGAGGGAGGGAGG + Intergenic
990109997 5:52310825-52310847 CATAGAGAGGAGAGAGAGGGAGG - Intergenic
990192720 5:53278539-53278561 CAAAATGAGGACAGGGCTAGTGG + Intergenic
990537659 5:56738789-56738811 CCAAAAGGGGAGAGGGAGGAAGG - Intergenic
990619073 5:57540431-57540453 CAAAAGCAGGAGAGAGAGAGAGG - Intergenic
990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG + Intergenic
990687512 5:58322748-58322770 AAGAAGGAAGAGAGGGAGGGAGG + Intergenic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
990831249 5:59960701-59960723 CAAAAAGAGGGGAGGGAGAGAGG + Intronic
991316948 5:65319664-65319686 AAAAAGGAAGGGAGGGAGGGAGG + Intronic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
991950058 5:71938857-71938879 CAAGATGAGGAGAGAGCAGGTGG - Intergenic
992143183 5:73819771-73819793 CAAAAATAAAAGAGGGAGGGAGG - Intronic
992362050 5:76049023-76049045 GAAAAAGAAAAGAGGGAGGGAGG + Intergenic
992874880 5:81044024-81044046 GAGAATGAGGAGAGGGATTGGGG + Intronic
993187501 5:84637939-84637961 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
993439390 5:87936979-87937001 GAAAAGGAAGGGAGGGAGGGAGG - Intergenic
993540319 5:89141315-89141337 CAATGTGAGGAGAGGGTGTGGGG + Intergenic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993820359 5:92607449-92607471 CAAATGTAGAAGAGGGAGGGAGG + Intergenic
994210605 5:97084344-97084366 AAAAATGAGGAGAGTTAGAGGGG + Intergenic
995086573 5:108117978-108118000 AAAAAGCAGGAGATGGAGGGAGG + Intronic
995559269 5:113363474-113363496 CAAAAGGAAGAGAGAGAAGGGGG + Intronic
996167112 5:120237839-120237861 GAGGAAGAGGAGAGGGAGGGGGG - Intergenic
996393242 5:122986483-122986505 AAAAAAGAGAAGTGGGAGGGTGG + Intronic
996506290 5:124271095-124271117 TAAAATGGGGAGAGGAAGGGAGG + Intergenic
996663004 5:126026737-126026759 CAAAATGTGGGCAGGGCGGGGGG + Intergenic
996701694 5:126456662-126456684 TAAAAGGAAGAGAGGGAAGGAGG - Intronic
997045834 5:130316254-130316276 CCAAAAGTGGAGAGGGTGGGAGG + Intergenic
997396881 5:133568056-133568078 CAAAAATGGGGGAGGGAGGGTGG + Intronic
998072465 5:139208783-139208805 CAGAATGTGGAAAGGGAGAGGGG + Intronic
998187650 5:139994919-139994941 GAAGATGAGGAGATGGAAGGAGG + Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998611515 5:143694310-143694332 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
998622703 5:143812296-143812318 AAAAAAGAGGTGAGGGAGCGAGG + Exonic
999161044 5:149499300-149499322 AAAAAAGGGGAGGGGGAGGGGGG + Intronic
999256318 5:150211671-150211693 AACAAAGAGGAGTGGGAGGGGGG - Intronic
999270122 5:150291895-150291917 CCAGGAGAGGAGAGGGAGGGTGG + Intergenic
999522249 5:152362862-152362884 CCAATTGAGGAGAGGCTGGGGGG - Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999818918 5:155204857-155204879 AAAATTGAGGAGAGGGAAGGTGG + Intergenic
999859793 5:155633365-155633387 CTGAAAGAGGACAGGGAGGGTGG - Intergenic
1000180081 5:158800627-158800649 CAAAATGAGGAGAGAAGGGGAGG - Intronic
1000209802 5:159098595-159098617 GAAAATGGAGAGAGGAAGGGAGG + Intronic
1000247085 5:159457724-159457746 CAAGAGGAAGGGAGGGAGGGGGG + Intergenic
1000480426 5:161766922-161766944 AAAAATGAAGAAAGGGAGGGAGG + Intergenic
1000583157 5:163058628-163058650 AAAGATGGAGAGAGGGAGGGAGG + Intergenic
1000625168 5:163529942-163529964 AAAAAAAAGGAGGGGGAGGGAGG + Intergenic
1000770304 5:165344783-165344805 TAAAAGGAAGAGAGGGAGGAGGG + Intergenic
1000796519 5:165671339-165671361 CAAATAGAGGAAAGGGAGGCAGG + Intergenic
1000909163 5:166999935-166999957 TAAAATGAGGAAAAGGAGGTGGG + Intergenic
1000975747 5:167762448-167762470 GAAAATAACGAGAGGAAGGGAGG - Intronic
1001099688 5:168804008-168804030 GAAAATGATGAAGGGGAGGGCGG + Intronic
1001129580 5:169052869-169052891 CAGAGTGGGGTGAGGGAGGGTGG - Intronic
1001220901 5:169900044-169900066 CTAAATGGAGAGAGGGAAGGAGG - Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001274880 5:170343336-170343358 AGAAAAGAGGAGAGGGAGGCTGG - Intergenic
1001547064 5:172576912-172576934 CTAAAAGAGGAGGGAGAGGGAGG + Intergenic
1001849946 5:174954926-174954948 CAAAATGGGGAAAGGAAGGGAGG + Intergenic
1001957841 5:175860560-175860582 GAAAAAGAAGGGAGGGAGGGAGG + Intronic
1002428381 5:179188956-179188978 CAAATTCAGGAGAGGGGGAGGGG - Intronic
1002764823 6:230102-230124 AAAAATGAGGGGTGGGTGGGGGG - Intergenic
1002891337 6:1335384-1335406 CAAGGAGAGGAAAGGGAGGGCGG - Intergenic
1002924421 6:1596514-1596536 CAAAAGGAGGGGAGGGGGCGCGG + Intergenic
1003038022 6:2662028-2662050 CTAAATTAGGAGTGGGAGAGAGG + Intergenic
1003476078 6:6484389-6484411 CAAAAAGAAGAAAGGGAGGGAGG + Intergenic
1003608501 6:7587448-7587470 CCAAATTAGGAGAGGGAGTAAGG - Intergenic
1004341824 6:14814470-14814492 AAGAAGGAAGAGAGGGAGGGAGG + Intergenic
1004341907 6:14815264-14815286 CGAAATGATGAGAGAAAGGGAGG + Intergenic
1004387333 6:15184456-15184478 TAAAATGTGGAGTGGGGGGGGGG - Intergenic
1004527872 6:16426253-16426275 CAAAAGGAGGAGAGGGCTGGTGG + Intronic
1004565473 6:16791998-16792020 CCCAATGGGGAGAGGGAGGGAGG - Intergenic
1004898100 6:20168728-20168750 GAAAAGGAAGGGAGGGAGGGAGG + Intronic
1005000504 6:21235504-21235526 AAAAATGAAGAGAGAGAGGGAGG + Intergenic
1005069688 6:21851760-21851782 GGAAGTGAGGAGAGGGAGGTGGG - Intergenic
1005665106 6:28044448-28044470 AAAAAAGGGGGGAGGGAGGGAGG + Intergenic
1005813727 6:29534014-29534036 AAGAAGGAAGAGAGGGAGGGAGG - Intergenic
1005959943 6:30687317-30687339 GACAATGAGGAGAGGGAAGGGGG + Exonic
1006216615 6:32449195-32449217 AAAAAAGAAGGGAGGGAGGGAGG + Intergenic
1006216631 6:32449261-32449283 TAAAAAGAAGGGAGGGAGGGAGG + Intergenic
1006459630 6:34150856-34150878 CAAAAAGAAGGGAGGGATGGTGG + Intronic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006575779 6:35044517-35044539 CAAAGTGAGGAGAGGGAACAGGG - Intronic
1006582295 6:35083982-35084004 CAAAATGAGAAGATGAAGGGGGG + Intronic
1007752956 6:44081175-44081197 CAAAATGGGGCAGGGGAGGGGGG + Intergenic
1007838005 6:44690924-44690946 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1008410925 6:51178984-51179006 AAAAATGAGGAGAATGAAGGGGG - Intergenic
1008468513 6:51856999-51857021 CCAAATGAGGAGACTGAGGCAGG + Intronic
1008541950 6:52553177-52553199 TCAAATGTGGAGAGGCAGGGAGG - Intronic
1008608702 6:53166211-53166233 CCAAAAGAGGGGAGGGTGGGAGG + Intergenic
1008648347 6:53539232-53539254 CAGGATGAGGAGAGGTAAGGGGG - Intronic
1009369901 6:62886127-62886149 CAAAAGCAGAAAAGGGAGGGAGG + Intergenic
1010800407 6:80168429-80168451 GAAAAGGAAGAGAGGGAGGGAGG + Intronic
1010809396 6:80281743-80281765 GAGAATGAGGACAGGGAGAGGGG - Intronic
1011085607 6:83537334-83537356 AGAAAAGAAGAGAGGGAGGGAGG - Intergenic
1011175900 6:84559882-84559904 AAAAAGGAAGAGAGGGAAGGAGG - Intergenic
1011632284 6:89339442-89339464 AAAAAAGAGGAGAGGAGGGGAGG + Intronic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1011958821 6:93060050-93060072 CAAAACGAGGGCAGGGCGGGAGG + Intergenic
1012172465 6:96035178-96035200 ACATATGAGGAGAGGGAGGGAGG + Intronic
1012257170 6:97047586-97047608 CAAAGTGAGGAGAGTAAGGGAGG - Intronic
1012337085 6:98073571-98073593 CAAAATGAGGAAATGGAGTTGGG + Intergenic
1013308325 6:108870609-108870631 GAAAAAGAAGAGAGGGAGGGAGG + Intronic
1013840476 6:114386641-114386663 CAAAGAGAGGAAAAGGAGGGAGG + Intergenic
1014177768 6:118349012-118349034 CAGAAGGAAGAGAGGGAGAGAGG - Intergenic
1014191189 6:118498644-118498666 GAAAGGGAGGAAAGGGAGGGAGG + Intronic
1014351577 6:120352806-120352828 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1014552832 6:122808657-122808679 AGAAAGAAGGAGAGGGAGGGAGG - Intronic
1014696833 6:124632418-124632440 CAAGATGAGGGTAGGGATGGGGG - Intronic
1015063518 6:128997379-128997401 AGAAAGGAAGAGAGGGAGGGAGG + Intronic
1015086090 6:129293660-129293682 AAGAAGGAAGAGAGGGAGGGAGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015234114 6:130951255-130951277 AAAAAAAAGGAGGGGGAGGGGGG + Intronic
1015591454 6:134826686-134826708 GAAAAGAAGGAGAGGGAAGGGGG + Intergenic
1015597641 6:134881042-134881064 CAAAAGCAAAAGAGGGAGGGAGG - Intergenic
1015600230 6:134904307-134904329 CAAAATGAGGGAAGGTAAGGAGG + Intergenic
1015727054 6:136309841-136309863 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1016002063 6:139051702-139051724 CATAATGTTGAGAGAGAGGGAGG + Intergenic
1016299790 6:142617875-142617897 CAAAATGTAGAGAGGGAAGTAGG + Intergenic
1016510473 6:144837159-144837181 CAGAAGGAAGAAAGGGAGGGAGG - Intronic
1016547342 6:145239064-145239086 AAAAAGGGAGAGAGGGAGGGAGG - Intergenic
1016722862 6:147323052-147323074 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1016747922 6:147600615-147600637 CTAAATGAGGAGAGGGAGAGTGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017437991 6:154435777-154435799 GAATAGGAGGAGAGGCAGGGGGG - Intronic
1017512648 6:155128054-155128076 GAAAAGGGGGAGAAGGAGGGAGG - Intronic
1017754319 6:157516973-157516995 CAACATGGCAAGAGGGAGGGTGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1017869420 6:158474249-158474271 CAAAGGGTGGAGAGGGAGGCTGG + Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018323046 6:162633783-162633805 CAGGATGAAGCGAGGGAGGGAGG + Intronic
1018846442 6:167560114-167560136 CCACAGGAGAAGAGGGAGGGAGG - Intergenic
1019564401 7:1672232-1672254 CCAGAGGAGGGGAGGGAGGGCGG + Intergenic
1019805054 7:3117575-3117597 GAGAAAGAGGAGAGGGAGGGAGG + Intergenic
1019819782 7:3234055-3234077 CAAATTCGGGAGAGGGAGGGAGG + Intergenic
1019919999 7:4157383-4157405 AGGAATGAGGGGAGGGAGGGAGG + Intronic
1020164342 7:5796414-5796436 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020604552 7:10320035-10320057 AAAAATGAGGAAATGGAGGGAGG - Intergenic
1020735325 7:11941933-11941955 AAAAATGGAGGGAGGGAGGGAGG - Intergenic
1020990024 7:15184604-15184626 AAGAAGGAAGAGAGGGAGGGAGG + Intergenic
1021059932 7:16099255-16099277 TAAAAAGAGGAGAGGGAGAGGGG + Intronic
1021279105 7:18694903-18694925 GAAAATGAGGAGTAGGAGGGAGG - Intronic
1021427810 7:20522628-20522650 AAAGAGGAGGAGAGGGAGGCTGG + Intergenic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1021954178 7:25807294-25807316 CAAAACGAAGGGAGGGAGGAGGG + Intergenic
1021971090 7:25966715-25966737 CAAAGGGAAGAGTGGGAGGGAGG + Intergenic
1022016226 7:26350681-26350703 AAAAATGGAGGGAGGGAGGGTGG - Intronic
1022037810 7:26550571-26550593 AAAAATGAGGAGGAAGAGGGAGG + Intergenic
1022289069 7:28983936-28983958 CAGGAGGAGGAGAGAGAGGGAGG + Intergenic
1022336266 7:29424835-29424857 GTAAAGGAGGTGAGGGAGGGTGG - Intronic
1022393012 7:29959947-29959969 GAAAGTGGGGGGAGGGAGGGAGG + Intronic
1022595674 7:31711598-31711620 AAAAATTAAGAGAGAGAGGGTGG - Intergenic
1022624842 7:32024877-32024899 TAAAATGAGGAAAGGTAGTGGGG - Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1022956242 7:35384391-35384413 AAAAATGAAGGCAGGGAGGGAGG + Intergenic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023763976 7:43493782-43493804 CAAAATCTGGAGAGGCATGGGGG + Intronic
1023778483 7:43633832-43633854 AAGAAAGAGGAGAGGGAGGGTGG - Intronic
1023844555 7:44113459-44113481 CGAAATTCAGAGAGGGAGGGCGG + Intronic
1023991692 7:45132556-45132578 AGGAAGGAGGAGAGGGAGGGAGG + Intergenic
1024144935 7:46504649-46504671 AAGAAGGAGGAGAGGAAGGGAGG + Intergenic
1024266825 7:47613133-47613155 AACACTGGGGAGAGGGAGGGAGG - Intergenic
1024570211 7:50716923-50716945 CCAGATGAGGGGAGGGAGGAAGG + Intronic
1024797260 7:53035440-53035462 GAGAAAGGGGAGAGGGAGGGAGG + Intergenic
1025187262 7:56870980-56871002 CAACTTGGTGAGAGGGAGGGTGG - Intergenic
1025321636 7:58100485-58100507 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1025474784 7:60905745-60905767 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1025480925 7:60981794-60981816 AAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1025488111 7:61077241-61077263 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1025512219 7:61584129-61584151 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1025794304 7:64723627-64723649 CAAAATGAGGAAGGTGAGGCTGG + Intergenic
1025838420 7:65119416-65119438 TAAAAAGAGGAGGGGGAGGGAGG - Intergenic
1025878857 7:65513680-65513702 TAAAAAGAGGAGGGGGAGGGAGG + Intergenic
1025884652 7:65576565-65576587 TAAAAAGAGGAGGGGGAGGGAGG + Intergenic
1025921879 7:65920843-65920865 AGAAAGGAAGAGAGGGAGGGAGG + Intronic
1026064016 7:67053345-67053367 CCAAATGAAAAGAGGGAGAGAGG - Intronic
1026086824 7:67269621-67269643 GAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1026133153 7:67636824-67636846 GAAAAAGAAGAGAGGGAGGAAGG - Intergenic
1026223194 7:68418225-68418247 GTATATGAGGAGAGGGAGGATGG - Intergenic
1026229204 7:68468716-68468738 AAGAAAGAAGAGAGGGAGGGAGG + Intergenic
1026251549 7:68675427-68675449 CAAAAGGGAGAGAGGGTGGGAGG - Intergenic
1026520508 7:71113711-71113733 GAAAAAGAGGGGAGGGAGGGAGG - Intergenic
1026690289 7:72545109-72545131 GAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1026690303 7:72545166-72545188 GAAAAGGAAGAGAGGGAGGGAGG + Intergenic
1026714332 7:72774099-72774121 CCAAATGAAAAGAGGGAGAGAGG + Intronic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1026799221 7:73388025-73388047 GAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1026870367 7:73847409-73847431 CAAAAGGGAGAGAGGGAGGGAGG - Intergenic
1026890886 7:73981542-73981564 GAAAGGAAGGAGAGGGAGGGAGG + Intergenic
1026904083 7:74052814-74052836 GAAAAAGAAAAGAGGGAGGGAGG + Intronic
1027657492 7:80948606-80948628 AGAAAGGAAGAGAGGGAGGGAGG + Intergenic
1027733554 7:81905133-81905155 AAGAAAGAGGGGAGGGAGGGAGG - Intergenic
1027815075 7:82958365-82958387 AAGGATGGGGAGAGGGAGGGAGG - Intronic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028600087 7:92591580-92591602 AAAAATGCAGGGAGGGAGGGAGG - Intergenic
1028837794 7:95394268-95394290 GACAATAAGGAAAGGGAGGGAGG + Intronic
1029495594 7:100894373-100894395 AAAGATGAGGGGAGAGAGGGAGG + Intronic
1029788407 7:102816762-102816784 CCAAATGTGGGGAGGCAGGGAGG - Intronic
1030771653 7:113483194-113483216 CAAAATGGGGATAGGAAGGTAGG - Intergenic
1031003955 7:116451238-116451260 GAACATGAGTAGAGTGAGGGAGG - Intronic
1031065543 7:117101097-117101119 CAAACAGAGGAGAGGGATGATGG + Intronic
1031180757 7:118412108-118412130 AAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1031351642 7:120739221-120739243 GAGAATGAAGGGAGGGAGGGAGG + Intronic
1031567344 7:123317129-123317151 CAAAAGGAGGGGAGGGTGGGAGG + Intergenic
1031626713 7:124000709-124000731 CAGAAAGAAGAGAGGGAGAGAGG + Intergenic
1032523694 7:132563744-132563766 GAAAAGGAGGAGAAGGAGGAGGG - Intronic
1033256436 7:139805638-139805660 GAAAAAGAAGGGAGGGAGGGAGG - Intronic
1033590289 7:142802974-142802996 CAAGATGAGGACAGAGAGGAAGG + Intergenic
1033644161 7:143288198-143288220 CAAAAGGAGGGGAAGGAGCGGGG - Exonic
1033663175 7:143417639-143417661 AGAAAGGAAGAGAGGGAGGGAGG - Intergenic
1033874317 7:145795458-145795480 AGAAAAGAGGAGAGGAAGGGAGG + Intergenic
1034205535 7:149311429-149311451 CCAAAAGGGGAGAGGGAGGGAGG - Intergenic
1034328705 7:150263054-150263076 CTAAATGAAGAGAGGTATGGAGG + Intronic
1034584623 7:152078176-152078198 TAGAAGGAGAAGAGGGAGGGGGG + Intronic
1034764511 7:153706331-153706353 CTAAATGAAGAGAGGTATGGAGG - Intergenic
1034889768 7:154829512-154829534 GAAAATGGAGAGAGGGAGGAAGG + Intronic
1034895696 7:154875151-154875173 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1034982731 7:155489079-155489101 CTAAATGAGAAGTGGCAGGGAGG - Intronic
1035022409 7:155807419-155807441 CAAACTGAAGAGGTGGAGGGAGG + Intronic
1035156610 7:156919591-156919613 CACAATGAGGAGAGTGTGAGGGG - Intergenic
1035255805 7:157626394-157626416 CAAAATGTAGAGAAGGATGGCGG - Intronic
1035520191 8:269771-269793 AAAAAGAAAGAGAGGGAGGGAGG + Intergenic
1035574333 8:695482-695504 GAAGGAGAGGAGAGGGAGGGAGG - Intronic
1035596354 8:861063-861085 GGACATGAGGAGAGGGAGTGGGG + Intergenic
1035824227 8:2627429-2627451 CAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1035971951 8:4258512-4258534 AAGAATGAAGGGAGGGAGGGAGG + Intronic
1036428618 8:8669127-8669149 CAAAATGAACAGAGGGTTGGTGG - Intergenic
1036456562 8:8914267-8914289 CCAAATGAGGCCAGGCAGGGTGG + Intergenic
1036760347 8:11504322-11504344 CAAAATAAAGAAAGGAAGGGAGG + Intronic
1037071736 8:14658895-14658917 AAAAATGAGGAAAGGAAGGAGGG + Intronic
1037085000 8:14837612-14837634 CCAAATGAGGGAAGAGAGGGTGG - Intronic
1037289467 8:17335931-17335953 AATAAAGAGGAGAGGGAGGGTGG - Intronic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1037691245 8:21183308-21183330 GAAAATGAGGGGAGGAAGGGAGG - Intergenic
1037773739 8:21818938-21818960 AAAGATGAGGAGGAGGAGGGTGG - Intergenic
1037777429 8:21844918-21844940 CAAGATGAGGTGAGGGAGGTGGG - Intergenic
1037806430 8:22060150-22060172 CAGGAAGAGGGGAGGGAGGGAGG - Intronic
1037920641 8:22803085-22803107 GAGAGTGAGGAGAGGCAGGGAGG - Intronic
1038067122 8:23974777-23974799 GAAAAGGAGGAGAAAGAGGGAGG + Intergenic
1038117197 8:24570704-24570726 GAAAATAGAGAGAGGGAGGGAGG - Intergenic
1038320157 8:26518325-26518347 CAAAAGGAGGAAAGTGGGGGTGG + Intronic
1038481034 8:27901942-27901964 GAAAATGGGGAGATGGAGGCTGG + Intronic
1038667661 8:29554250-29554272 AAAAAGAAGGGGAGGGAGGGAGG - Intergenic
1038762413 8:30396497-30396519 CAGAACGAGGAGAGGGATGTGGG + Intronic
1038806204 8:30794489-30794511 GAAAAGGAAGGGAGGGAGGGAGG - Intronic
1039069230 8:33634594-33634616 GGCAAAGAGGAGAGGGAGGGGGG + Intergenic
1039364476 8:36915922-36915944 AAAAAGGAAGAAAGGGAGGGAGG + Intronic
1039498275 8:37997570-37997592 GAAAAGAAGGAGAGAGAGGGAGG - Intergenic
1039612968 8:38933532-38933554 CAAAATGAGGTCAGGGGTGGTGG + Intronic
1039625345 8:39044623-39044645 CCAAAAGAGGAGAGGGTAGGAGG - Intronic
1040034668 8:42858819-42858841 AGAAATTTGGAGAGGGAGGGAGG + Intronic
1040513832 8:48118349-48118371 TAATATGAGGAGGGGAAGGGAGG + Intergenic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1040773555 8:51010818-51010840 CCAAAAGGGGAGAGAGAGGGTGG - Intergenic
1041173177 8:55166102-55166124 GCAAATGAGGTGGGGGAGGGAGG + Intronic
1041243709 8:55871363-55871385 GGAGATGAGGAGAGGGAGTGTGG + Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041499365 8:58523180-58523202 CAAACTTAGGAGAGGGATGTGGG - Intergenic
1041546802 8:59054943-59054965 GAAAAAGAGAGGAGGGAGGGAGG + Intronic
1041659990 8:60392069-60392091 CAGAAGGAGGCGAGGGAGTGAGG - Intergenic
1041675991 8:60540478-60540500 CAAAAAGAAGAAAGGGAGGGAGG - Intronic
1041908973 8:63067762-63067784 ACAAGAGAGGAGAGGGAGGGAGG - Intronic
1042072464 8:64950667-64950689 CAAAAGGAAGAGAGAGAGGGTGG + Intergenic
1042602741 8:70514010-70514032 CAAAATGATGAAAGGGAAAGAGG - Intergenic
1042928709 8:73992784-73992806 CCAAAGGAGGAGAGGGAAGTGGG - Intronic
1043014177 8:74917902-74917924 GAAAAAGAAGAGAGGGAGGGAGG + Intergenic
1043057212 8:75454054-75454076 AGAAAGGAAGAGAGGGAGGGAGG - Intronic
1043057221 8:75454082-75454104 AGAAAGGAAGAGAGGGAGGGAGG - Intronic
1043266581 8:78273706-78273728 AAAAAAGAAGAGAGGGAAGGAGG - Intergenic
1043314551 8:78904052-78904074 AAAAATGAGGAGTGGGAGAGTGG - Intergenic
1043320367 8:78977132-78977154 AAAAATGAGGCAAGGTAGGGTGG - Intergenic
1043417266 8:80063969-80063991 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1043638342 8:82414830-82414852 TAATGTGAGTAGAGGGAGGGAGG - Intergenic
1044163982 8:88957347-88957369 ACAAAGGGGGAGAGGGAGGGAGG + Intergenic
1044326425 8:90864330-90864352 AACAAGGAAGAGAGGGAGGGAGG + Intronic
1044605192 8:94042029-94042051 GAAAATGAGGTGGGGAAGGGAGG + Intergenic
1044747421 8:95384260-95384282 CAGATTGAGGAGTGGGATGGAGG + Intergenic
1044756044 8:95462033-95462055 AAAAAGGAAGAGAGGAAGGGAGG - Intergenic
1045065930 8:98444313-98444335 AGAGATGAGGAGAGGGAGGTGGG + Intronic
1045155299 8:99462177-99462199 CAAAAGGAAGAGATGGAGGGAGG - Intronic
1045706881 8:104934205-104934227 ACAAATAAAGAGAGGGAGGGAGG + Intronic
1045725136 8:105163473-105163495 AAAAAAGAAGAGAGGGAGAGAGG - Intronic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046605330 8:116365473-116365495 GAAAAAGCGGGGAGGGAGGGAGG + Intergenic
1046745571 8:117872153-117872175 GAAAAGGAAGGGAGGGAGGGAGG + Intronic
1046839117 8:118837991-118838013 CACAATGAGGTGCTGGAGGGTGG - Intergenic
1046996683 8:120531549-120531571 AAAAATTAGGAGGGGGCGGGTGG + Intronic
1047277943 8:123419812-123419834 AAAAAGGGAGAGAGGGAGGGAGG - Intronic
1047525938 8:125634089-125634111 CACAGTGAGGGGAGGGCGGGTGG - Intergenic
1048206362 8:132418369-132418391 AAAAAGCAGGCGAGGGAGGGAGG + Intronic
1048391551 8:133970507-133970529 CAAAAGGGAGAGAGAGAGGGAGG + Intergenic
1048414600 8:134212309-134212331 GAAAAGGAAGGGAGGGAGGGAGG - Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049365902 8:142236745-142236767 CAACATGAGGAGAGGGACTGGGG - Intronic
1049406695 8:142454773-142454795 AAAAAAGAAGAGAGGGAGGGTGG - Intronic
1049829631 8:144692215-144692237 CCAGATGAGGGCAGGGAGGGAGG - Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050094651 9:2051454-2051476 GGAAATGAGGAGATGGGGGGTGG - Intronic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050615939 9:7401772-7401794 GAAAATGGGGAGAGGGAGTCTGG + Intergenic
1050638779 9:7642749-7642771 CCAAAAGAGGGGAGGGAGGAGGG - Intergenic
1050830861 9:10010477-10010499 AAAAATGAGGAAAATGAGGGAGG + Intronic
1050885669 9:10762171-10762193 AAAAAGAAGGAGAGGGAGAGAGG + Intergenic
1051058718 9:13020589-13020611 GAAAATGAGGACAGGGATGAGGG - Intergenic
1051258663 9:15239752-15239774 CCAAAAGAGGGGAGGGAGGATGG + Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1052224047 9:26062544-26062566 AAAAATGGAGAGAGAGAGGGGGG + Intergenic
1053345885 9:37378020-37378042 TAAAATGAGGTGAGGGTGGGGGG - Intergenic
1053366877 9:37529062-37529084 CAAATGGAGGAGAGACAGGGAGG + Intronic
1053553325 9:39107284-39107306 AAGAAAGAAGAGAGGGAGGGAGG + Intronic
1053698421 9:40661694-40661716 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1053817434 9:41927445-41927467 AAGAAAGAAGAGAGGGAGGGAGG + Intronic
1054107684 9:61071096-61071118 AAGAAAGAAGAGAGGGAGGGAGG + Intergenic
1054309712 9:63461101-63461123 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1054408501 9:64785243-64785265 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1054441654 9:65269054-65269076 GAAAAAGAGGAAAGGAAGGGAGG - Intergenic
1054454046 9:65420471-65420493 AGAAAAGAAGAGAGGGAGGGAGG + Intergenic
1054488626 9:65752435-65752457 GAAAAAGAGGAAAGGAAGGGAGG + Intergenic
1054613173 9:67260029-67260051 AAGAAAGAAGAGAGGGAGGGAGG - Intergenic
1054795308 9:69295961-69295983 AAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1055084992 9:72304926-72304948 GAAAAGGAAGAGAGGGAGGCTGG - Intergenic
1055149919 9:72984568-72984590 CCAAATGAAGAGAGAGAGAGAGG - Intronic
1055381325 9:75710102-75710124 GAGAGAGAGGAGAGGGAGGGAGG - Intergenic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055468288 9:76586979-76587001 AAAAATGAGCAGGGGCAGGGAGG + Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056441336 9:86624646-86624668 AAAAAAGGAGAGAGGGAGGGTGG - Intergenic
1056869491 9:90264215-90264237 CAAAATGAGGAGAGGTAGGGTGG - Intergenic
1057167404 9:92939981-92940003 GGAAAGGAGGGGAGGGAGGGAGG - Intergenic
1057523418 9:95778675-95778697 ACAAAGGAGGAAAGGGAGGGAGG - Intergenic
1057784387 9:98075445-98075467 GAAAGGGAGGAAAGGGAGGGAGG + Intronic
1057829321 9:98394855-98394877 CAGAATGAGGGAAGGGATGGTGG - Intronic
1057861868 9:98647020-98647042 CACAATGAGAAGAGGCAGGGAGG + Intronic
1058343419 9:103926701-103926723 GAAAAGGAGCAGAGGGAGAGAGG + Intergenic
1058445010 9:105047062-105047084 CAAAATGTGGAAAGAGAGGCTGG - Intergenic
1058569576 9:106326236-106326258 GAGAATCAAGAGAGGGAGGGAGG + Intergenic
1058749099 9:108021381-108021403 TAAAATGAGGAGTGGAATGGTGG + Intergenic
1059021349 9:110579757-110579779 AAAAAAGAGGAGAGCGAGAGGGG - Exonic
1059035339 9:110748209-110748231 GAAAAGGAAAAGAGGGAGGGAGG - Intronic
1059130901 9:111748649-111748671 AAAAAGGAAGAGAGGGAGGGAGG - Intronic
1059352874 9:113678033-113678055 GAAAAAGAAGGGAGGGAGGGTGG - Intergenic
1059396239 9:114035742-114035764 GAAAGGGAGGAGAGGGAGGGAGG - Intronic
1059410086 9:114126440-114126462 AAGAAAGAGGAGAGGGAGGGAGG - Intergenic
1059942773 9:119374012-119374034 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1060088660 9:120723558-120723580 CAAGATGATGAGAGGAAGGAAGG + Intergenic
1060400089 9:123343613-123343635 CAAAATGAAGAGAGGCTGCGTGG - Intergenic
1060769762 9:126324069-126324091 CAAACTTAGAATAGGGAGGGAGG - Intergenic
1060925962 9:127455335-127455357 CACAATGGGGACAGGGTGGGTGG + Intronic
1060943632 9:127557467-127557489 CAGGAAGAGGGGAGGGAGGGCGG + Intronic
1061369140 9:130188004-130188026 CAAAGTGGGGAGATGGGGGGTGG + Intronic
1061401346 9:130370073-130370095 CAAGAGGGAGAGAGGGAGGGAGG - Intronic
1061969828 9:134038938-134038960 CAAAAAGGAGAGAGGGAGGGAGG + Intronic
1062199870 9:135296870-135296892 CAACAGGAGGTGAGGCAGGGCGG + Intergenic
1062670318 9:137704966-137704988 GAAAAGGAAGAGAGAGAGGGAGG - Intronic
1202780784 9_KI270717v1_random:34889-34911 GAAAAAGAGGAGAGGAAGGGAGG - Intergenic
1203581739 Un_KI270746v1:13125-13147 TAAAAGGAGGAAAGGAAGGGAGG + Intergenic
1203655074 Un_KI270752v1:15865-15887 AAAAAGGTGGAGAGGGAGGGAGG + Intergenic
1185562495 X:1070486-1070508 CAAAAAGAAGGAAGGGAGGGAGG + Intergenic
1185791724 X:2932353-2932375 AAAAAGGAAGAAAGGGAGGGAGG - Intergenic
1185806985 X:3067092-3067114 AAAAAGGAAGGGAGGGAGGGAGG - Intronic
1185937738 X:4277830-4277852 AAAAATGAGGAAAGGAAGGAAGG - Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186823924 X:13318721-13318743 CAAAATGACGAGAGAGATGTGGG - Exonic
1187231790 X:17430237-17430259 AAGAAAGAGGGGAGGGAGGGAGG - Intronic
1187260365 X:17679847-17679869 CAGAATGAAGAAAGGGGGGGGGG + Intronic
1187414241 X:19078860-19078882 CAAAATCAAGAGACAGAGGGAGG + Intronic
1187538489 X:20166667-20166689 GAAAATGAGGGGAGGGAGGGAGG - Intronic
1187695347 X:21913710-21913732 GAAAAAGAGAGGAGGGAGGGAGG + Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1188402424 X:29762531-29762553 CAAAAGGAAGAGAGGGAGAGAGG + Intronic
1188426089 X:30048627-30048649 CAAGAGGAAGAGAGAGAGGGGGG - Intergenic
1188595345 X:31893566-31893588 AAAAAAGGGGAAAGGGAGGGAGG + Intronic
1189014995 X:37087736-37087758 CAGAACGAGGAGAGGGATGTGGG + Intergenic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1189457652 X:41207850-41207872 CAAAATGAGAGATGGGAGGGAGG - Intronic
1189868010 X:45351734-45351756 TAAAATGAGCAGATGGAGAGGGG + Intergenic
1189907223 X:45773813-45773835 CAAAATGAAGAGAGGGTGGTTGG + Intergenic
1190232185 X:48590651-48590673 CAGATTGAGGAGAGGGGGCGAGG + Intronic
1190435202 X:50417669-50417691 CAGAATGAGGATAGAAAGGGAGG - Intronic
1190471251 X:50781762-50781784 CAGGATGAGGTGAGGGAGTGAGG - Intronic
1190532909 X:51397587-51397609 AAAAATGTGTAGAGGGAGAGAGG - Intergenic
1190708288 X:53048515-53048537 CAAATCGAGGAGAGGGGGGACGG + Intergenic
1191895421 X:65987438-65987460 AAAAATGAGGAGGGGGAGAAAGG + Intergenic
1191937761 X:66443178-66443200 AAAAATGAGAAGGGGGAGGAGGG - Intergenic
1192360666 X:70436792-70436814 AAAAATGAAGAGAGAGAGGGTGG + Intergenic
1192486915 X:71535266-71535288 CAAAACGTTGGGAGGGAGGGAGG - Intronic
1193074428 X:77340586-77340608 AAAAATGAGAAGAGAGAGGGTGG + Intergenic
1193375012 X:80749320-80749342 AAAACTGAAGGGAGGGAGGGAGG - Intronic
1194418231 X:93638920-93638942 CAAAATGAAGAGAGAGAGGAGGG - Intergenic
1194975377 X:100390858-100390880 CAAAATGAGCAGAGGCATGGTGG + Intronic
1195025060 X:100868512-100868534 CAAAAACAGAAGAGGGAGGGAGG - Intronic
1195086496 X:101418512-101418534 CATTAGGAGGAGGGGGAGGGCGG + Intronic
1195110142 X:101639946-101639968 GAAATTTAGGAGAGGGAGGAGGG + Intergenic
1195579653 X:106487043-106487065 GAAAAAGAAGGGAGGGAGGGAGG - Intergenic
1195908054 X:109864849-109864871 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1196047083 X:111267710-111267732 CTTAATGGGGAGAGGGAGAGAGG + Intronic
1196079047 X:111611557-111611579 CAAAAAGGGAAGAGTGAGGGGGG - Intergenic
1196083743 X:111661422-111661444 CAAGAGGAAGAGAGGGAAGGGGG - Intergenic
1196203043 X:112907770-112907792 GAAAGAGAGGAGAGGGAGAGAGG + Intergenic
1196281589 X:113828989-113829011 AAAAAAGAAGGGAGGGAGGGAGG + Intergenic
1196858437 X:120005312-120005334 TAGAAAGAGCAGAGGGAGGGGGG - Intergenic
1196938295 X:120751200-120751222 AAAAAGGAGAAGAGGGAGGGTGG - Intergenic
1197531462 X:127632957-127632979 AAAGATGAGCAGAGGGATGGAGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197714930 X:129699808-129699830 CAAAATGAGGAGAGTGGTGCAGG - Intergenic
1198116500 X:133549782-133549804 AAAAAGAAGGACAGGGAGGGAGG - Intronic
1198116512 X:133549826-133549848 AAAAAGAAGGACAGGGAGGGAGG - Intronic
1198208131 X:134488422-134488444 CAAAATGAGGCCAGGCAGGGTGG - Intronic
1198235751 X:134734632-134734654 AAAAATGTGCTGAGGGAGGGAGG - Intronic
1198706173 X:139450822-139450844 AAAAAGGAGGAGAGGGAAGGAGG + Intergenic
1198737356 X:139801399-139801421 AAAAGTGATGAGAAGGAGGGAGG + Intronic
1198754763 X:139971138-139971160 AAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1199022681 X:142900221-142900243 AAAAAGGAAGCGAGGGAGGGAGG + Intergenic
1199153008 X:144511442-144511464 CCAAAAGGGGAGAGGGTGGGAGG + Intergenic
1199220102 X:145308100-145308122 CAAAAGGAAGAGAGAGATGGGGG + Intergenic
1199241989 X:145557545-145557567 CAAAAGGAAGAGAGAGAGGAAGG - Intergenic
1199508222 X:148590456-148590478 AAAAAGGAAGAAAGGGAGGGAGG - Intronic
1199710923 X:150468501-150468523 CAAAATAAGGAAAGGAAGAGAGG - Intronic
1199865625 X:151847671-151847693 GAAAAGGAGGAGAGAGAGAGAGG + Intergenic
1200088098 X:153620658-153620680 CGAATGGGGGAGAGGGAGGGAGG + Intergenic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200699588 Y:6390788-6390810 CAAAATGAAGGGAGGAAGTGAGG - Intergenic
1200701993 Y:6410224-6410246 CAAAATGAAGGGAGGCAGTGAGG - Intergenic
1201032118 Y:9754474-9754496 CAAAATGAAGGGAGGCAGTGAGG + Intergenic
1201034523 Y:9773910-9773932 CAAAATGAAGGGAGGAAGTGAGG + Intergenic
1201074764 Y:10178782-10178804 GACAAGGAGGAGAGGGAAGGAGG - Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201269028 Y:12236475-12236497 TAAAATGAGGTGAGGCATGGTGG - Intergenic
1201451112 Y:14116097-14116119 CAATATGGAGGGAGGGAGGGAGG + Intergenic
1201451135 Y:14116169-14116191 CAATATGGAGTGAGGGAGGGAGG + Intergenic
1201575954 Y:15461379-15461401 AAAAAGGAAAAGAGGGAGGGAGG - Intergenic
1201711616 Y:16998952-16998974 CCAAAAGAGGAGAGGGTGAGAGG + Intergenic
1201716465 Y:17049250-17049272 CAAAAAGAAGGAAGGGAGGGAGG + Intergenic
1201782931 Y:17743279-17743301 AAGAAAGATGAGAGGGAGGGTGG + Intergenic
1201818622 Y:18162708-18162730 AAGAAAGATGAGAGGGAGGGTGG - Intergenic
1202182049 Y:22147982-22148004 CAGAATGAAGAGAGGCAGTGAGG - Intergenic
1202209311 Y:22438420-22438442 CAGAATGAAGAGAGGCAGTGAGG + Intergenic