ID: 1146235386

View in Genome Browser
Species Human (GRCh38)
Location 17:31155382-31155404
Sequence TCCCTTCAATTGTGTAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146235386 Original CRISPR TCCCTTCAATTGTGTAGCTG AGG Intronic
902297886 1:15480966-15480988 CCCCTTAAGTTGTGTACCTGAGG + Intronic
902520620 1:17013622-17013644 TGCCTTCCATTTTGTAGGTGAGG - Intergenic
902780956 1:18704783-18704805 TCCATTAATTTGTGTAGTTGAGG + Intronic
902928810 1:19716010-19716032 TCCCTTTAATTCTATAGTTGAGG - Intronic
905374382 1:37509191-37509213 TTCATCCAATTGTGTATCTGAGG - Intronic
905691113 1:39943604-39943626 TCCCAGCATTTGGGTAGCTGAGG - Intergenic
908029996 1:59988970-59988992 CCCCTGCATTTGTGTAGCTTGGG + Intronic
916280639 1:163047567-163047589 ACCCTTCACTTGTGCACCTGAGG + Intergenic
919715352 1:200770142-200770164 TCCCTACAATTCTGTACCTTCGG - Intronic
1066304410 10:34126159-34126181 TCACTTCAATTATGGAGCTAAGG + Intronic
1068707861 10:60096827-60096849 CTCCCTCAATTCTGTAGCTGTGG - Intronic
1071842232 10:89484551-89484573 TCACTGCCATTGTGTAGGTGAGG + Intronic
1072285219 10:93908052-93908074 TCCCTTCAATCATGGAGATGTGG - Intronic
1076455404 10:130589572-130589594 TCCCTTCATTTGAGGAGCTGGGG - Intergenic
1078920439 11:15825773-15825795 TCCCTTCATTTGTCTGTCTGGGG + Intergenic
1079275064 11:19028014-19028036 TACCATCAATTGTACAGCTGTGG - Intergenic
1082293797 11:50413399-50413421 TCCCTTGAATTCTGCAGCAGAGG - Intergenic
1083178591 11:60970129-60970151 TCTTTTAAAATGTGTAGCTGAGG - Intergenic
1087682152 11:101230136-101230158 TCACTTCAAGAGTGAAGCTGTGG + Intergenic
1090234528 11:125137653-125137675 CCCCTTCAATGATGTATCTGTGG - Intergenic
1091163129 11:133444859-133444881 TACCTGAAATTGTGTAGATGGGG - Intronic
1091163146 11:133444950-133444972 TACCTGAAATTGTGTAGATGGGG - Intronic
1091163162 11:133445041-133445063 TACCTGAAATTGTGTAGATGGGG - Intronic
1091163178 11:133445132-133445154 TACCTGAAATTGTGTAGATGGGG - Intronic
1091271824 11:134319571-134319593 TCCCTTCAATTGAGTATGGGAGG - Intergenic
1095316608 12:40769736-40769758 TCCCTTAAATTTTGCACCTGAGG + Intronic
1095676195 12:44921528-44921550 TCATTTCCATTGTGCAGCTGAGG - Intronic
1097259798 12:57712045-57712067 TCCCTACAAAGGTGTATCTGTGG + Intronic
1098130524 12:67345334-67345356 TCCCTTCAATTATATAATTGGGG - Intergenic
1101919797 12:108923173-108923195 TCCCCTTGATTGTGTAGATGGGG + Intronic
1102694734 12:114789952-114789974 TCACTGCAAATGCGTAGCTGAGG + Intergenic
1104540674 12:129661555-129661577 ACCCTTCCATTGTTTAGATGTGG - Intronic
1105400826 13:20093708-20093730 TCCATTTAATTGTGAAACTGAGG - Intergenic
1106341214 13:28828690-28828712 TCCCTTAAATTTTGTACCTGAGG - Intronic
1107893327 13:44933305-44933327 TCCCAGAAGTTGTGTAGCTGTGG - Intergenic
1108480556 13:50865949-50865971 TCCCTCTAATTATGTAGATGAGG - Intergenic
1109983311 13:69940033-69940055 TCCTTACCATTGTGTAGCTGTGG + Exonic
1112694808 13:101936139-101936161 TCCCTTCCATTGTCCAGATGAGG + Intronic
1116708911 14:48339545-48339567 TCCATTCAATTGTATAGTTTTGG + Intergenic
1118976654 14:70683750-70683772 TCCCTTCAATTTTCAAGCTTAGG + Intergenic
1119075458 14:71633707-71633729 TCCCTTCCATTTTGTCTCTGGGG - Intronic
1121288557 14:92755879-92755901 TCCCTGCCATTGTAAAGCTGAGG - Intergenic
1125893651 15:43284310-43284332 TCCCTTTATTTGTGTATCTCTGG - Intronic
1128893743 15:71354177-71354199 TCCCTGCTATTGGGAAGCTGAGG + Intronic
1133825358 16:9273408-9273430 TGCCTGCAAGTATGTAGCTGTGG - Intergenic
1134888073 16:17812181-17812203 TCTCTTCCATTTGGTAGCTGTGG + Intergenic
1145016954 17:19405341-19405363 TCACTTCCATTGTATAGATGAGG - Intergenic
1146235386 17:31155382-31155404 TCCCTTCAATTGTGTAGCTGAGG + Intronic
1149200588 17:54181506-54181528 TCTCTTCAAGTGTGTAGATTAGG - Intergenic
1149689557 17:58563133-58563155 TCCCTTCAATTTTGTATCCAAGG + Intronic
1153998881 18:10466471-10466493 TCCCTTTAGTTGTTCAGCTGTGG - Intronic
1158790467 18:60774586-60774608 ACACTTCAATTGGGCAGCTGAGG - Intergenic
1159379592 18:67639119-67639141 TACCTTCAAGTGGGTTGCTGAGG + Intergenic
1160078677 18:75702872-75702894 TCCCTGCCAAGGTGTAGCTGAGG - Intergenic
1162328255 19:10011263-10011285 TACCTCCTATTGTGCAGCTGAGG - Intergenic
1162396022 19:10418509-10418531 ACCCTCCAATTGAGTAGATGGGG - Intronic
1163583215 19:18150494-18150516 TCCCCTCAAATGGGTAGGTGTGG - Exonic
1167741545 19:51327251-51327273 TCCCTTCGATTGTGAGGCAGGGG + Intronic
926339260 2:11891227-11891249 CACCTTCAATTCTGTAGCTAAGG - Intergenic
927641854 2:24850380-24850402 CCCCTTCATTTGTGTTCCTGGGG + Intronic
927974665 2:27329143-27329165 TCCCTACAATGGTGTCACTGTGG - Exonic
940631772 2:156249398-156249420 TTACTTCAATTGTGTAACTTGGG + Intergenic
944613701 2:201438074-201438096 CCTCTTCAATTGTGTAGGTCTGG - Intronic
946726789 2:222669681-222669703 TCACTTCAACTTTGCAGCTGAGG - Intergenic
1170063241 20:12282672-12282694 TCCCTCCACTTGTGAGGCTGAGG + Intergenic
1170138713 20:13103775-13103797 TCTCTTCTCTTGTGCAGCTGTGG - Intronic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170674943 20:18470314-18470336 TCCCATCAATTTTCTAGCTCAGG + Intronic
1173984790 20:47252668-47252690 TCCCTGCAATTGGGAGGCTGAGG + Intronic
1177803773 21:25854183-25854205 TCCCTTAAATTTTGTTCCTGAGG - Intergenic
1182109787 22:27715073-27715095 ACCCTTCTATTTTGTAGATGAGG + Intergenic
1184587973 22:45460567-45460589 TCCCTTCAGCCGTGTGGCTGCGG + Intergenic
949695277 3:6687280-6687302 ACCCTTTGTTTGTGTAGCTGTGG + Intergenic
950517332 3:13475963-13475985 TCCCTTCATCTGTGCAGCTGAGG + Intergenic
956082778 3:65577504-65577526 TCCCTTCAATTCTGTGCCGGTGG + Intronic
956137504 3:66113617-66113639 TCCCATAAATTCTGAAGCTGTGG + Intergenic
956772364 3:72537353-72537375 GCCCTTCAGCTGTGTGGCTGTGG - Intergenic
959813618 3:110649189-110649211 TCCCTTCAACTGTGTATGTGGGG - Intergenic
962986102 3:140537510-140537532 CCCCTTCCTCTGTGTAGCTGTGG + Intronic
963298971 3:143578084-143578106 TCCCTTCTATAAAGTAGCTGTGG + Intronic
964054170 3:152432462-152432484 TCACTGGAATTTTGTAGCTGAGG - Intronic
971425917 4:26515278-26515300 TCCCTTCAATTTTAAAGTTGTGG + Intergenic
972285479 4:37643979-37644001 TGCCTTCATCTGTGTACCTGCGG - Intronic
973248378 4:48035229-48035251 TCCCTTTCATTGTGTAACAGGGG - Intronic
977418632 4:96766835-96766857 TCCCCTCATTTGTTTAGCTTTGG + Intergenic
978902371 4:113967555-113967577 TCACTTGAAGTGTGGAGCTGGGG + Intronic
982708065 4:158731900-158731922 TCCATCCAATTGTGTATCTCAGG - Intergenic
985867133 5:2522858-2522880 TCCTTTCAATGGAGAAGCTGGGG + Intergenic
989255681 5:39363549-39363571 TCACTTCAACAGTGTGGCTGGGG - Intronic
989267925 5:39499211-39499233 TCCCAACAATTGGGTGGCTGGGG + Intergenic
989622421 5:43397519-43397541 TCCCTTAAATTCTGCACCTGAGG - Intronic
992351234 5:75931242-75931264 TCCCTTCAAATGGTTAGATGTGG - Intergenic
993138740 5:84003117-84003139 TCCTTTCTATAGTGTGGCTGCGG - Intronic
995646318 5:114316517-114316539 ACCCAACAATTGTGTATCTGCGG - Intergenic
997859735 5:137405632-137405654 ACCTCTCACTTGTGTAGCTGGGG - Intronic
999088840 5:148917234-148917256 ACCATTCCATTGGGTAGCTGTGG + Intergenic
999509226 5:152230613-152230635 ACCCTTAAATTCTGCAGCTGAGG + Intergenic
1000252365 5:159507696-159507718 TCCATTAGATTGTGAAGCTGGGG - Intergenic
1002634945 5:180602681-180602703 TCCCTTCAACTGTGCAGGGGTGG + Exonic
1004442270 6:15664783-15664805 TCCCGTAAATTTTGTACCTGAGG - Intergenic
1006749520 6:36367832-36367854 TCCTTTTCATTATGTAGCTGGGG - Intronic
1009370803 6:62899439-62899461 TCCATTCAATTGTAAAGATGTGG + Intergenic
1010574790 6:77517713-77517735 TCACTTCAATTGAGAAGTTGTGG - Intergenic
1010950128 6:82026131-82026153 TCCCCTCAATTCTGTAGTTTTGG - Intergenic
1013070014 6:106720669-106720691 TCCCCCCAATTGTGGAGATGGGG + Intergenic
1014652651 6:124059531-124059553 TCCCTGCTATTGTGGAGCTTAGG - Intronic
1019883468 7:3883711-3883733 TCCCTCCCATTGTCTAGCAGAGG + Intronic
1021131203 7:16914863-16914885 TCCCTGCCATTGTGTATATGTGG + Intergenic
1022645567 7:32226083-32226105 TTGCTTCAATTGTGTAACAGAGG + Intronic
1027566268 7:79799036-79799058 AGACTTGAATTGTGTAGCTGTGG - Intergenic
1032272206 7:130419989-130420011 TCCCTTCCATTGTCTAGCATAGG + Intronic
1032842132 7:135722738-135722760 CCCCTTCAATTTTGGATCTGAGG + Intronic
1034208275 7:149338287-149338309 TCCCTTCAATTGTGTTGTTTTGG - Intergenic
1035446423 7:158946335-158946357 TCTCTTGAATTTTGTAGCTCAGG + Intronic
1037712676 8:21367852-21367874 TTTCTTCAATTGTGTTGGTGTGG - Intergenic
1038838108 8:31151172-31151194 TCATTTCCATTGTATAGCTGAGG - Intronic
1040578397 8:48674500-48674522 TCCCTTCAGTTATGCACCTGAGG - Intergenic
1041951766 8:63510965-63510987 TCCCAGCAATTGAGAAGCTGAGG + Intergenic
1042172565 8:66006378-66006400 TCCCATCATTTGTGCATCTGGGG + Intergenic
1046613799 8:116454114-116454136 TACCTGCAATTCCGTAGCTGGGG + Intergenic
1046704870 8:117438587-117438609 TACCTTAAATTTTGTACCTGAGG - Intergenic
1053469244 9:38334106-38334128 TCCCTCCCATTGTGTAGACGTGG - Intergenic
1055111961 9:72568520-72568542 TCTCTTCACCTTTGTAGCTGCGG - Intronic
1057768522 9:97945153-97945175 TCCCTTTAATTGCCTAGATGTGG + Intergenic
1057928431 9:99172617-99172639 TCTGTTCAATTGTTCAGCTGAGG - Intergenic
1059588775 9:115634781-115634803 TCCCTCCAATTGTGCAGCTTTGG + Intergenic
1060961508 9:127683901-127683923 TCCCTTCTGTTGTGTAGCCCCGG + Intronic
1061590707 9:131595823-131595845 AACCTTCAATTCTGTAGCAGTGG - Intronic
1189202214 X:39206143-39206165 CCCCTTAAATTTTGTACCTGAGG - Intergenic
1193856556 X:86610696-86610718 TCCCAGCAATTGTGAGGCTGAGG - Intronic
1196100688 X:111844402-111844424 TCCCTTAAATTGTATGCCTGAGG + Intronic
1196253730 X:113491830-113491852 TCCCTTAAATTTTATAGCTCTGG - Intergenic
1197206532 X:123795620-123795642 TTTCTTCAATATTGTAGCTGAGG - Intergenic
1200743531 Y:6881101-6881123 TTCCTTTAATTGTGTTGCTAAGG + Intergenic