ID: 1146236066

View in Genome Browser
Species Human (GRCh38)
Location 17:31164041-31164063
Sequence GTATCATCAAGGTTACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146236066_1146236068 -6 Left 1146236066 17:31164041-31164063 CCTCACAGTAACCTTGATGATAC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1146236068 17:31164058-31164080 TGATACTTCCCTCATTTTACAGG 0: 1
1: 0
2: 0
3: 24
4: 219
1146236066_1146236071 24 Left 1146236066 17:31164041-31164063 CCTCACAGTAACCTTGATGATAC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1146236071 17:31164088-31164110 ACTAATACTCAAAAAAGTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146236066 Original CRISPR GTATCATCAAGGTTACTGTG AGG (reversed) Intronic
905745361 1:40412447-40412469 GTATTCTTAAGGTTACTTTGTGG + Intronic
907175511 1:52518364-52518386 GTGTCAGCAAGGTCACTGTCTGG + Intronic
909362211 1:74775558-74775580 GCATCATCAAGGATAATGTGTGG - Intergenic
911474153 1:98355777-98355799 TCATCAGCAAGCTTACTGTGTGG + Intergenic
912677752 1:111701023-111701045 GAATTATGATGGTTACTGTGTGG - Intronic
913614530 1:120544886-120544908 CTATCATCAAAATTACTCTGTGG + Intergenic
914335135 1:146708079-146708101 ATATAATAAAGTTTACTGTGTGG + Intergenic
914575741 1:148966015-148966037 CTATCATCAAAATTACTCTGTGG - Intronic
914881122 1:151547929-151547951 GGCTCACCAGGGTTACTGTGAGG - Intronic
917725720 1:177825422-177825444 GTATCATCAAGGTTTCTTTGTGG + Intergenic
919115550 1:193276326-193276348 GGATCATCAAGGTGAATGGGAGG - Intergenic
1063571468 10:7218216-7218238 GTTTCATCATGGTCACTTTGTGG - Intronic
1063912184 10:10841798-10841820 GTATCAGCAAAGTTATTTTGTGG - Intergenic
1070297471 10:75175029-75175051 GTATCCTCAAGGCCACTTTGTGG + Intronic
1076385593 10:130052775-130052797 TTATCTTCAAGGGTACTGAGAGG - Intergenic
1091453870 12:590824-590846 TTACTATCAAGGTTACTGGGAGG + Intronic
1091453884 12:590948-590970 TTACTATCAAGGTTACTGGGAGG + Intronic
1091693952 12:2615805-2615827 GTCTCAGCAAGGGTACTGGGGGG + Intronic
1093390308 12:18610970-18610992 ATATCACCAAGTTTACTGTGTGG - Intronic
1093527843 12:20123828-20123850 GAATGAGCAAGGTTATTGTGAGG - Intergenic
1099785077 12:87251971-87251993 TTATAATCAAGCTTAGTGTGAGG + Intergenic
1109148258 13:58810469-58810491 GTGTCATTAAGGTGCCTGTGAGG + Intergenic
1110047391 13:70847294-70847316 GTACCAGCAAGGTTAGTGTTTGG - Intergenic
1110098791 13:71568982-71569004 GTATAATCAAGATTATTTTGAGG - Intronic
1114921163 14:27330749-27330771 TTATCATTATGGTTACTCTGAGG + Intergenic
1118134751 14:63011085-63011107 GAATCATAAAGGTTAATGGGAGG + Intronic
1122858303 14:104570679-104570701 CTAGCATCTAGGGTACTGTGAGG - Intronic
1124098740 15:26673536-26673558 GTATCATCAGTGTCACTGTATGG - Intronic
1125081204 15:35675661-35675683 GTATCCTCAAAGCTACTTTGGGG + Intergenic
1129802214 15:78423691-78423713 TTATCTTCAAGGTTATTATGAGG + Intergenic
1131296718 15:91155685-91155707 TTTTCATAAAGGCTACTGTGAGG - Intronic
1135763602 16:25157502-25157524 GTATCACCCAGGTTGCAGTGCGG - Intronic
1137315846 16:47321934-47321956 GTATCATCTACATTACTATGTGG + Intronic
1140237324 16:73171320-73171342 GTATCTTCAAGGAAACTGTAGGG + Intergenic
1140783998 16:78322678-78322700 TTATCAACAAAGTTACTCTGTGG + Intronic
1140867652 16:79078007-79078029 TTTTTATCAAGGTTAGTGTGTGG + Intronic
1143592582 17:7894467-7894489 GGATCACCAGGATTACTGTGAGG + Exonic
1143790689 17:9293003-9293025 GTATCATCATGGATACTGGTTGG + Intronic
1144262254 17:13533348-13533370 GTTTCTTCAAGGTTGCTGTGAGG - Intronic
1146236066 17:31164041-31164063 GTATCATCAAGGTTACTGTGAGG - Intronic
1147633079 17:41945128-41945150 GCATCAGGAAGGTCACTGTGGGG - Exonic
1148281663 17:46352919-46352941 GTTTCATTTAGGTTTCTGTGTGG - Exonic
1148303888 17:46570858-46570880 GTTTCATTTAGGTTTCTGTGTGG - Exonic
1150476920 17:65482627-65482649 GGATCAACAAGGTTACTGTCAGG - Intergenic
1156170795 18:34482558-34482580 TTATCATCAAGGTTAAGGTGGGG + Intergenic
1164891272 19:31825741-31825763 GTTTCAGCAAGATTACTCTGGGG - Intergenic
929498283 2:42466565-42466587 GTACCATCTAGGTTTGTGTGAGG + Intronic
929627252 2:43422033-43422055 ATATCATCAAGGTATCTGTTTGG - Intronic
931618355 2:64184570-64184592 CCATCCTCAAAGTTACTGTGAGG - Intergenic
933378701 2:81515441-81515463 GAATCAGGAAGGATACTGTGAGG + Intergenic
937978435 2:127596308-127596330 GCAACATCAAGGTCACTTTGAGG + Intronic
938690567 2:133785188-133785210 GTATGATAAAGGTTACCGTATGG + Intergenic
939314361 2:140528707-140528729 GTAGGAGCAAGGTGACTGTGGGG + Intronic
940855952 2:158728856-158728878 GTTTCATCAATGTTTCCGTGTGG + Intergenic
940883070 2:158967040-158967062 TTATCATTAAGGTTGCTGTCTGG + Intergenic
943265196 2:185721813-185721835 GAATCAACAAGGTTTTTGTGTGG - Intergenic
945958037 2:216104670-216104692 GTGACATCCAGGTTACTGTTGGG + Intergenic
1170983036 20:21232640-21232662 GTTTCACCAAACTTACTGTGAGG + Intronic
1171131500 20:22657897-22657919 TCATTATCAAGTTTACTGTGTGG + Intergenic
1173433287 20:43010359-43010381 GGATCAGCAAGGTGAGTGTGAGG - Intronic
1173433289 20:43010380-43010402 GGATCAGCAAGGTGAGTGTGAGG - Intronic
1179979287 21:44888032-44888054 GTGTCACCAAGGTCACCGTGGGG + Intronic
1179979301 21:44888095-44888117 GTGCCACCAAGGTCACTGTGGGG + Intronic
1179979315 21:44888158-44888180 GTGCCACCAAGGTCACTGTGGGG + Intronic
1183087136 22:35493319-35493341 CAATCATGAAGGTTGCTGTGGGG + Intergenic
950275946 3:11660980-11661002 GTGTCATCAGGGTGGCTGTGGGG + Intronic
950449962 3:13059926-13059948 GTATGCTCAGGGTTGCTGTGGGG + Intronic
953584786 3:44189771-44189793 GTTTCATTAAGGTTACCATGGGG + Intergenic
963995965 3:151709166-151709188 GTACCAGCTAGGTTACAGTGTGG + Intergenic
965481301 3:169222797-169222819 GCTTCAGCAAGGTTACTTTGTGG - Intronic
971515413 4:27480222-27480244 TTTTCCTCAAGGTTACTGTGAGG - Intergenic
977149568 4:93493372-93493394 GTATTATTAAGGTTATTTTGTGG - Intronic
978489021 4:109290730-109290752 CTATCATTAATGTTAATGTGTGG - Intronic
983683971 4:170385549-170385571 GTACCAACTAGGTCACTGTGGGG - Intergenic
990252256 5:53927965-53927987 GTATCTTTAAGGCTATTGTGTGG + Intronic
992541318 5:77767502-77767524 CTATCATTAAGTTTATTGTGGGG - Intronic
993809636 5:92459336-92459358 GTTTCATAAAGGTCACTCTGGGG + Intergenic
1001502185 5:172245762-172245784 GCACCATTTAGGTTACTGTGGGG - Intronic
1001599526 5:172919955-172919977 GTTTCCTCCAGGCTACTGTGAGG - Intronic
1016198996 6:141384750-141384772 GTACCATCAAAGTCCCTGTGAGG + Intergenic
1016605700 6:145922180-145922202 ATATAATAAAGGTTACTGTGGGG + Intronic
1024847349 7:53662392-53662414 GTAGAATAAAGGTTACTGTGGGG - Intergenic
1030945364 7:115712559-115712581 GGAACATCTAGTTTACTGTGAGG - Intergenic
1031262325 7:119536597-119536619 GTAAAAGCAAGGTTAATGTGAGG - Intergenic
1032638681 7:133739915-133739937 GCATCATTATTGTTACTGTGGGG + Intronic
1032641160 7:133770245-133770267 GTGTTATCCAGGTTATTGTGAGG + Intronic
1037043063 8:14261652-14261674 GTATGATCAACGTTACTCTTTGG - Intronic
1037395998 8:18444090-18444112 GTACCATCTAGGTTTGTGTGAGG + Intergenic
1039594529 8:38779351-38779373 GTTTCATCTAAGTGACTGTGTGG - Intronic
1039697818 8:39931181-39931203 TTATTCACAAGGTTACTGTGAGG + Intergenic
1041573075 8:59359755-59359777 GTATACTCTAGGTTACTGTTTGG - Intergenic
1047176596 8:122547067-122547089 GTATCATCCAGGTTTATGGGTGG - Intergenic
1048567940 8:135623391-135623413 GTTTCATAAGGTTTACTGTGCGG - Intronic
1049152407 8:141043584-141043606 TTATCATCAACGTCACTGTCTGG - Intergenic
1050218482 9:3358167-3358189 CTATCAAAAGGGTTACTGTGAGG + Intronic
1060768457 9:126312599-126312621 GTAGCTTCAAGGTCACTCTGAGG + Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1061650195 9:132041487-132041509 GTAGCATGATGGTTACTGTCTGG - Intronic
1062171079 9:135135058-135135080 GTATCTGGAAGGTGACTGTGAGG - Intergenic
1186290416 X:8091457-8091479 GGATCATGTAGGTTAATGTGCGG + Intergenic
1186932607 X:14411377-14411399 ATATCACCAAGGTCACTGAGAGG + Intergenic
1187583898 X:20638931-20638953 GTATCAGCTAGGTTTCTGTCAGG + Intergenic
1190101721 X:47527177-47527199 GCAGCATCCAGGTAACTGTGGGG + Intergenic
1192478866 X:71467684-71467706 CTACCCTCAAGGTTATTGTGAGG - Intronic
1194074970 X:89380020-89380042 ATATAATCAAGATTATTGTGAGG + Intergenic
1199778441 X:151036217-151036239 GGGTCATCAAGGTGACAGTGAGG + Intergenic
1199833680 X:151567455-151567477 GTGTCATCAAGGTTTCTTTTTGG + Intronic
1200730570 Y:6734191-6734213 ATATAATCAAGATTATTGTGAGG + Intergenic