ID: 1146241020

View in Genome Browser
Species Human (GRCh38)
Location 17:31226195-31226217
Sequence AACAGATGGTAGCATTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146241020 Original CRISPR AACAGATGGTAGCATTATGT TGG Intronic
901200378 1:7463668-7463690 AACAGATGGTGGGAGTAGGTGGG + Intronic
902421855 1:16286968-16286990 AAAAGGTGGTAGCATAATCTAGG - Intronic
908559064 1:65286633-65286655 AAAAGATGGTAGGAGTGTGTTGG + Intronic
909763629 1:79325919-79325941 AACAGAAGTTAGACTTATGTTGG + Intergenic
913364801 1:118025676-118025698 GACAGAGGGTCTCATTATGTTGG + Intronic
915964055 1:160291196-160291218 AACAGAGGGTAGCATTCTGTTGG + Intronic
917056553 1:170988352-170988374 TGCAGATGGGAGCATTCTGTAGG + Intronic
918839139 1:189512597-189512619 AACAGAAAGCAGCATTTTGTAGG - Intergenic
922341699 1:224662068-224662090 ATCAGATGTTAGCATTTTATAGG + Intronic
923635299 1:235690601-235690623 AACAAATGGTGGCAATATTTTGG + Intronic
923934170 1:238743200-238743222 AACAGATGATAACATGATGGAGG - Intergenic
1064944772 10:20775047-20775069 AACAGAGTGCAGCATTATTTTGG + Intergenic
1067957999 10:50814417-50814439 AATAAGTGGTCGCATTATGTTGG - Intronic
1068499354 10:57823654-57823676 GACAGATGATAGCATCATATTGG + Intergenic
1069295405 10:66837686-66837708 AACAAATGGAAGCTTAATGTGGG - Intronic
1070885302 10:79890564-79890586 AACAGATGTTATCCTTCTGTGGG - Intergenic
1071190995 10:83100464-83100486 ACCATATGTTATCATTATGTTGG - Intergenic
1071374927 10:84992627-84992649 AACAAATGATAGCATGATCTGGG - Intergenic
1074612514 10:115035875-115035897 TACAGTTTGTAGCAATATGTAGG - Intergenic
1077548948 11:3191030-3191052 AGTAGATGGTAGCATTAAGTAGG + Intergenic
1078771440 11:14356339-14356361 AATTGATGAAAGCATTATGTAGG - Intronic
1080032181 11:27673354-27673376 AAAAGATGTTGGCATTATGTGGG + Intronic
1084712075 11:70850024-70850046 AACAGAGGGTAGGATGATGAGGG - Intronic
1086822251 11:91448157-91448179 AACAGATGCTAGCAATATTGTGG + Intergenic
1087273159 11:96132944-96132966 ATCAGAAAGTAGCAGTATGTTGG - Intronic
1087498776 11:98924032-98924054 GACAGATTGTAGGATTATTTAGG + Intergenic
1090649666 11:128795153-128795175 AAAAGATGGTAAAATTAAGTGGG + Intronic
1091498048 12:989956-989978 AACAGTTGGTAGTCATATGTGGG + Intronic
1093598822 12:20996621-20996643 AAATGATGCTAGCATTTTGTTGG + Intergenic
1093818077 12:23574638-23574660 ATCAGATGGCAGAATGATGTTGG - Intronic
1094427944 12:30335164-30335186 AACAGATAGAAGCATACTGTAGG - Intergenic
1095132316 12:38558839-38558861 AAATGATGGTAGCAGTTTGTAGG - Intergenic
1095532218 12:43202030-43202052 TACATATGATATCATTATGTGGG + Intergenic
1099582294 12:84465533-84465555 ATCAGAATGTAGCATTATCTTGG - Intergenic
1100689310 12:97023022-97023044 AACAGATGCTACCATTAGGAGGG + Intergenic
1102076931 12:110067099-110067121 AAAAGATGGTTGCATTCTCTTGG - Intronic
1103376102 12:120457295-120457317 TACAGATGGTGGCATTAAGGTGG + Intronic
1104187965 12:126450473-126450495 GACAAATGGTTGCATTATTTTGG + Intergenic
1105461572 13:20594726-20594748 AATAGATGGTAGTTTTATGAAGG - Intronic
1107352215 13:39527478-39527500 AACAGATGGAACCATGTTGTCGG - Intronic
1109008073 13:56903590-56903612 ATCAGATGGTAGCATTAGTCTGG + Intergenic
1109411028 13:61969874-61969896 GACAGATGGAAGGATTAGGTAGG - Intergenic
1110399944 13:75078496-75078518 CACAGATGGTAGAAGTATGAGGG - Intergenic
1113756677 13:112816690-112816712 AACACAAGGTAGCATTATTTAGG - Intronic
1114049172 14:18906411-18906433 GACAGATAGTAGCTTTATATTGG - Intergenic
1114113392 14:19495520-19495542 GACAGATAGTAGCTTTATATTGG + Intergenic
1114115097 14:19613274-19613296 GACAGATAGTAGCCTTATGTTGG + Intergenic
1114410914 14:22499640-22499662 CATAAATGGTAACATTATGTTGG + Intergenic
1116902134 14:50371688-50371710 AACAGATGGGAGCCTCAGGTTGG + Intronic
1118695487 14:68380848-68380870 AACTGAAGGTTGCCTTATGTGGG - Intronic
1119920752 14:78443889-78443911 AACAGTTAGTAGCATTAGGTTGG + Intronic
1123505240 15:20935911-20935933 GACAGAGAGTAGCTTTATGTTGG - Intergenic
1123562479 15:21509613-21509635 GACAGAGAGTAGCTTTATGTTGG - Intergenic
1123598724 15:21946890-21946912 GACAGAGAGTAGCTTTATGTTGG - Intergenic
1125107230 15:35986417-35986439 TCCTGATGGTAGAATTATGTAGG - Intergenic
1126000055 15:44200490-44200512 AACAAATGGTACAATTATGTAGG + Intergenic
1129593179 15:76935914-76935936 AACAGATAGAAGGATCATGTAGG - Intronic
1202970831 15_KI270727v1_random:236753-236775 GACAGAGAGTAGCTTTATGTTGG - Intergenic
1133854533 16:9537187-9537209 AACTGCTGGTATCGTTATGTCGG + Intergenic
1135397959 16:22145799-22145821 AACAGATGGTTGTTTTTTGTGGG + Intronic
1141544283 16:84753899-84753921 AACAGATGGCAGCTGTTTGTAGG + Intronic
1141938705 16:87259872-87259894 ACCAGATGGTAGAAATTTGTGGG + Intronic
1146241020 17:31226195-31226217 AACAGATGGTAGCATTATGTTGG + Intronic
1149282085 17:55117687-55117709 TACAGATGTTTACATTATGTGGG + Intronic
1155450874 18:25961367-25961389 AACAGAAGTTAGCATGCTGTAGG - Intergenic
1156932115 18:42658244-42658266 AAAAGATGGCACCATTATCTAGG - Intergenic
1159142231 18:64411354-64411376 AACAGATTGAAGCATTATTATGG - Intergenic
927771063 2:25861970-25861992 ATCAGATGGTAGAATGATGAGGG + Intronic
928718579 2:34092671-34092693 AGTAGATGGGAGTATTATGTTGG - Intergenic
928920253 2:36519667-36519689 TACAGATGGAAGCATCATGAGGG - Intronic
931718847 2:65052528-65052550 AAGAGATGGTTTCATCATGTTGG - Intergenic
932402106 2:71487981-71488003 AACAGATGGAAGAATCCTGTTGG + Intronic
935529931 2:104219766-104219788 AACAGATGGTATTTTTAAGTGGG + Intergenic
936504754 2:113096678-113096700 AAATGATGGTGGCATTTTGTTGG + Intergenic
936956370 2:118026601-118026623 AACAAATGGTTGCATTATTTTGG + Intergenic
938426485 2:131194561-131194583 GACAGATAGTAGCTTTATGTTGG - Intronic
940219501 2:151337112-151337134 CCCAGATGGTAGCTGTATGTAGG + Intergenic
941463459 2:165797974-165797996 AACACAATGTAGAATTATGTTGG - Intergenic
944108512 2:196105577-196105599 AAATGCTGGTATCATTATGTTGG + Intergenic
944359544 2:198836845-198836867 GACAGAAAGTAGCAGTATGTAGG + Intergenic
946852364 2:223919762-223919784 AACATATGGTATCAATATTTAGG - Intronic
1169436786 20:5599922-5599944 AAGAGGTGGTAGCTTTATGTTGG - Intronic
1170925033 20:20714683-20714705 AACATATAGTATTATTATGTTGG + Intergenic
1171146822 20:22791848-22791870 ACCAGATGTTTGCATGATGTTGG + Intergenic
1172295839 20:33810658-33810680 AACAGATGGTAGAGGTATGTTGG + Intergenic
1174758343 20:53181958-53181980 AAGTGATGGTAGCAACATGTGGG + Intronic
1174879132 20:54258112-54258134 AACAGGTGGTAGAATGAAGTAGG + Intergenic
1177266012 21:18784985-18785007 AATAGATGGTAGCATCATGTTGG - Intergenic
1178243297 21:30926967-30926989 AACAAATGTTTGCATTATGAGGG + Intergenic
1180467650 22:15628786-15628808 GACAGATAGTAGCTTTATGTTGG - Intergenic
1184328220 22:43808224-43808246 AGCATATGGGAGGATTATGTAGG + Intronic
951088860 3:18548014-18548036 AAAAAATAGTAGCATTCTGTAGG - Intergenic
952657957 3:35809082-35809104 AAGAGATTGTAGCTTTTTGTTGG + Intergenic
953791122 3:45949146-45949168 AACAGTAGGTAGGATCATGTGGG - Intronic
955420782 3:58734975-58734997 AATAGATGGCATCTTTATGTGGG + Intronic
955718206 3:61853471-61853493 AACAGCTGGTACCATTTTGCTGG + Intronic
957361869 3:79170428-79170450 AACAGATTGGTGGATTATGTTGG - Intronic
957627621 3:82674209-82674231 AACAGAAGTTACCATTATGTTGG + Intergenic
958590088 3:96145869-96145891 AGCAGATGGTATTATTCTGTTGG + Intergenic
962092567 3:132260597-132260619 AACTGTTGGTAGCTTGATGTTGG + Intronic
962824088 3:139083329-139083351 TATAGATGGTAGAATTATATGGG + Intronic
965718865 3:171638445-171638467 AACAGATTGCAGCATGATGGTGG - Intronic
966065131 3:175812257-175812279 AAAAGATGGTGGCATTGAGTAGG - Intergenic
966178220 3:177162891-177162913 AACATTTGGTAACACTATGTTGG + Intronic
969012996 4:4082597-4082619 AACAGATAGCAACCTTATGTTGG - Intergenic
970607077 4:17690962-17690984 GACAGATTGTAGCATCATTTAGG + Intronic
973589997 4:52431544-52431566 AACAAATGGTATCACAATGTGGG + Intergenic
974309335 4:60184269-60184291 AAGAGGTGGTAGCATTGTGGAGG - Intergenic
974972654 4:68848533-68848555 AACATTTGGTACCATTCTGTAGG - Intergenic
976972894 4:91129340-91129362 ATCAGGTGGTAGCCTCATGTTGG - Intronic
977111219 4:92958074-92958096 CACAGGTGATATCATTATGTAGG - Intronic
978065623 4:104396374-104396396 GAGAGAGGGTAGCATTGTGTTGG - Intergenic
979459085 4:120959617-120959639 AACAGTTGGTATCAACATGTTGG + Intergenic
980431900 4:132711710-132711732 AAAAAATGGTAGTATTATGTGGG - Intergenic
980586491 4:134823237-134823259 AGTAAATGGTAGTATTATGTGGG - Intergenic
981199116 4:141957670-141957692 AAGAAATGATAGCATTATGCAGG - Intergenic
981492009 4:145349357-145349379 GACAGAAGGCAGCATTATGCTGG - Intergenic
983130324 4:164011622-164011644 AACAGATGCTGGCAAGATGTGGG + Intronic
985118324 4:186614589-186614611 AACATATAATAGCATTTTGTAGG - Intronic
986326782 5:6681587-6681609 TACAGATGGAAGCATTAAGGAGG - Intergenic
988687324 5:33537839-33537861 AATAGCTGGGGGCATTATGTTGG + Intronic
991094831 5:62728739-62728761 AACACAAGGTCTCATTATGTTGG - Intergenic
991966311 5:72094887-72094909 TACAGATGGTAGCTATGTGTAGG + Intergenic
992912637 5:81412195-81412217 TAGTGGTGGTAGCATTATGTAGG - Intergenic
995069604 5:107904334-107904356 AAGAGATGGTAGAGTTATTTAGG - Intronic
995561892 5:113391213-113391235 AAGAGATGGGAGCATGATGATGG + Intronic
1000013264 5:157253649-157253671 AACAGAGGGCAGCATTGTGTTGG + Exonic
1000836333 5:166159299-166159321 AACATATAGTAACATTATATAGG + Intergenic
1006582770 6:35086331-35086353 AACAGATGGCAGCGGTAGGTAGG - Intronic
1006767541 6:36521861-36521883 AACACATGAAAGCATTAGGTTGG - Intronic
1008462442 6:51791148-51791170 AACAGATGGTATCATCAAGCAGG - Intronic
1008706511 6:54166881-54166903 AACATATGGAATCATTTTGTGGG - Intronic
1010373232 6:75135940-75135962 AACTGATGCTAGAATTATTTTGG - Intronic
1010726060 6:79335118-79335140 AAGAGATGGTATTTTTATGTGGG - Intergenic
1011972132 6:93238812-93238834 AACAGCTGGTAGGAGTGTGTGGG + Intergenic
1016240543 6:141924430-141924452 AAAAGATGTTAGTATTCTGTAGG - Intergenic
1018479774 6:164178756-164178778 AACAGATTGGAGCATTTTCTGGG + Intergenic
1022341339 7:29471413-29471435 AACAGCTGGTGGTATCATGTGGG + Intronic
1023487355 7:40701237-40701259 AAAAGATGGTTGCTTAATGTTGG - Intronic
1023642663 7:42276122-42276144 TCCAGATGGTTGCATTTTGTGGG + Intergenic
1025039710 7:55630496-55630518 AACAAATGGTTGCATTCTTTTGG + Intergenic
1028892583 7:96004846-96004868 AACACATGGCAGCATTAGCTTGG + Intronic
1032496061 7:132363759-132363781 AACAGATGGTGGCAGTATGATGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1037223132 8:16550523-16550545 AACAGAAGGAAGCATTTTTTGGG - Intronic
1039019899 8:33193768-33193790 AACAGATGTTAGACTTAAGTGGG + Intergenic
1039465263 8:37780872-37780894 AACAGCTGGTAGACTTGTGTAGG + Intergenic
1039721728 8:40171868-40171890 AATAGATGGTAGCTTTATAAGGG - Intergenic
1045609739 8:103824940-103824962 TACACATTGTAGCTTTATGTTGG + Intronic
1047483825 8:125310084-125310106 AACAGATGGTATCTTTCTATTGG + Intronic
1050052536 9:1618164-1618186 AACAGATGGCATCTTTGTGTGGG + Intergenic
1051629696 9:19129846-19129868 AAAAGATGGAGGCATTTTGTAGG - Intronic
1051706237 9:19883421-19883443 ACCAGACTGTAGCATTTTGTAGG + Intergenic
1052839996 9:33284765-33284787 AACATTTGGTAGAATCATGTGGG + Intergenic
1054849815 9:69836176-69836198 AAAAGTTGGCAGCTTTATGTTGG + Intronic
1055164004 9:73168592-73168614 AAGAGATGGTAGAATTAGGCAGG + Intronic
1055772541 9:79732809-79732831 AACATATGGAAGTAGTATGTGGG - Intergenic
1060447892 9:123708644-123708666 TGCAGATGGTAGGGTTATGTGGG + Intronic
1186286735 X:8052405-8052427 AAAAGATGGTATCATTGTTTTGG + Intergenic
1186790043 X:12988395-12988417 AACAGATGTTTGCATTATAAAGG + Intergenic
1187572780 X:20521706-20521728 AAGAGATGGTACCACGATGTCGG + Intergenic
1189755019 X:44262173-44262195 AACAGATTGCAGCAATATTTGGG - Intronic
1189907218 X:45773781-45773803 GACAGATGGTAACATAATGGGGG + Intergenic
1191006075 X:55712754-55712776 AAGAGCTGCTAGCAGTATGTAGG + Intergenic
1193264349 X:79450959-79450981 GACAGATGGTTGCATTACTTTGG + Intergenic
1197013813 X:121599621-121599643 AACAGAATTTAGCATTATATAGG + Intergenic
1197386220 X:125806013-125806035 AACACATGGAAGCATAGTGTGGG + Intergenic
1199194234 X:145008091-145008113 AACAGATGTTAGCATTTCCTGGG + Intergenic
1199729879 X:150621437-150621459 AACAACTGGCAGCATTGTGTAGG - Intronic
1200408637 Y:2840222-2840244 GACAAATGGTTGCATTATTTTGG - Intergenic