ID: 1146241690

View in Genome Browser
Species Human (GRCh38)
Location 17:31234782-31234804
Sequence AAGGATTACAATAATGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146241690_1146241695 18 Left 1146241690 17:31234782-31234804 CCTACCACATTATTGTAATCCTT 0: 1
1: 0
2: 4
3: 17
4: 176
Right 1146241695 17:31234823-31234845 AGAGCTATGAGCCATGATCCTGG 0: 1
1: 4
2: 2
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146241690 Original CRISPR AAGGATTACAATAATGTGGT AGG (reversed) Intronic
900715810 1:4142750-4142772 AAGCATCTCAATAATGTGTTGGG - Intergenic
907602011 1:55781440-55781462 AAGGATTTTAATAACGTGATTGG - Intergenic
910029990 1:82708011-82708033 AAAGAATACAATAAAGTAGTAGG - Intergenic
910472545 1:87570956-87570978 TAGCATTAAAATAATGTAGTTGG + Intergenic
910622870 1:89275106-89275128 AAGGACTACAATAAAGTGCTTGG - Intergenic
912617783 1:111123195-111123217 AAGGATAACAACAATTTGGGTGG - Intronic
912837927 1:113013129-113013151 AAAAAATACATTAATGTGGTTGG - Intergenic
915852096 1:159335292-159335314 AATTATTACAATAGTATGGTAGG + Intergenic
915919900 1:159968308-159968330 AAGAATTACAAAAATGAGATGGG - Intergenic
917701968 1:177590574-177590596 AAAATTTAAAATAATGTGGTAGG - Intergenic
918440284 1:184559776-184559798 AAGAATTACAAAAATTTGCTGGG - Intronic
919223239 1:194659228-194659250 AAGGATTAAAAAAATGAGATAGG - Intergenic
919665716 1:200289560-200289582 AAGAAGTACAATAATGTGGCTGG + Intergenic
921371682 1:214430108-214430130 AAGGATACCTAGAATGTGGTAGG - Intronic
921442086 1:215199515-215199537 AAGGAAAACAATAATGAGCTTGG + Intronic
921769264 1:219015913-219015935 AAGGAGTAAAAGAATGTGTTAGG + Intergenic
922682958 1:227616172-227616194 AAGGAATACAAGAAAGAGGTGGG - Intronic
923663761 1:235980732-235980754 AAGAATTACAATGAAGTGATTGG + Intronic
923873353 1:238020103-238020125 AACTATTACAATAATATGCTCGG - Intergenic
924165219 1:241274208-241274230 AAAGATGACAAAGATGTGGTGGG - Intronic
924561346 1:245158175-245158197 AAGGTCTAAAATAATTTGGTAGG - Intronic
1063201655 10:3790091-3790113 AAAGATTAAAATAATCTAGTGGG - Intergenic
1063945678 10:11173933-11173955 AATGATGACGATAATGTGTTGGG + Intronic
1068233066 10:54196436-54196458 AAAAATTACAATAATTTGGCTGG - Intronic
1070205909 10:74261204-74261226 AAGGCTATAAATAATGTGGTGGG - Intronic
1071030195 10:81169869-81169891 AAGGATTCCTAGAATGTGATTGG + Intergenic
1071795213 10:88997606-88997628 CAGGTTTTCAATAATGTAGTAGG + Intronic
1073879591 10:107965429-107965451 ATGGTTTACAATCATTTGGTTGG - Intergenic
1079737522 11:24014574-24014596 ATAGTTTACAATAATGTAGTAGG + Intergenic
1080680968 11:34475698-34475720 AAAGAAAACATTAATGTGGTTGG - Intergenic
1081045044 11:38263306-38263328 AATAATTACAATAATTTGTTAGG - Intergenic
1081515990 11:43830520-43830542 AAAGAATACGATAAAGTGGTAGG - Intronic
1083701031 11:64477781-64477803 AAGGCTTACAATGTTGTGGGAGG + Intergenic
1088153007 11:106770212-106770234 AAAGATTTAAAGAATGTGGTAGG - Intronic
1090707037 11:129347463-129347485 ATGGATTAACAAAATGTGGTAGG + Intergenic
1097904865 12:64909308-64909330 CATGATTACAGTAGTGTGGTGGG + Intergenic
1098163115 12:67666639-67666661 AAAGATTATAAAAATGGGGTGGG + Intergenic
1098962867 12:76757045-76757067 AATGAATACAATAAAGTTGTAGG + Intergenic
1099276220 12:80579094-80579116 ATAGATTACAATGATCTGGTAGG - Intronic
1100449749 12:94694682-94694704 ACAGATTACAATAATGAGGGAGG + Intergenic
1101047151 12:100820208-100820230 ATGGATTCCAACAATGTGGTAGG - Intronic
1101218587 12:102611578-102611600 AACGATTATTATAATGTAGTGGG + Intergenic
1101421670 12:104555953-104555975 AGGGATTACCATCAGGTGGTGGG + Intronic
1101724303 12:107376328-107376350 AAGGCCTACAATTATGTGCTGGG - Intronic
1102165208 12:110800685-110800707 AAAGATTACACTAATGTGTGAGG - Intergenic
1103858378 12:123991100-123991122 AAGAATCATAATAATTTGGTGGG - Intronic
1105960873 13:25337243-25337265 AAGTATTAAAATTAAGTGGTAGG + Intronic
1106417322 13:29557089-29557111 AAAAATTACAATAAATTGGTTGG - Intronic
1107327822 13:39263980-39264002 CAGTATTAAAATAGTGTGGTGGG - Intergenic
1108166907 13:47702758-47702780 AAGGATTATAATAATCAGGTGGG + Intergenic
1108575370 13:51785827-51785849 AAGGACAACAAAATTGTGGTTGG - Intronic
1109295733 13:60528219-60528241 AAGGAGTAAGATAATGAGGTAGG + Intronic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1109605265 13:64686062-64686084 AAAGAAGACAATTATGTGGTTGG - Intergenic
1111150440 13:84246541-84246563 AAGGATACCAATAATGTAATGGG - Intergenic
1112786370 13:102955929-102955951 AAGGATAGCAAGAATGTGCTGGG + Intergenic
1114780257 14:25531420-25531442 AAGGATAAACATAATGTGTTTGG + Intergenic
1116502552 14:45638044-45638066 AAGGATTAGATTAATGGGGTTGG + Intergenic
1117469902 14:56033094-56033116 GAGGATTACAAAAATTTGGGTGG - Intergenic
1118609475 14:67528952-67528974 AAGGATTCCAATGAGGAGGTGGG - Intronic
1119491323 14:75036328-75036350 AAAGATGTCAAGAATGTGGTTGG - Intronic
1119800129 14:77436737-77436759 ATGTATAACAATAATGTGGCCGG - Intronic
1123504578 15:20927558-20927580 CAGGATTACAATAATGTGATAGG + Intergenic
1123561825 15:21501259-21501281 CAGGATTACAATAATGTGATAGG + Intergenic
1123598069 15:21938540-21938562 CAGGATTACAATAATGTGATAGG + Intergenic
1124054648 15:26231213-26231235 TAGGATTACAATAAGGTGGGAGG - Intergenic
1127213065 15:56795261-56795283 AAGGATGACAATTATGTCTTTGG + Intronic
1127299084 15:57634932-57634954 TAGGAGGACAATAATGTGGGAGG - Intronic
1202970170 15_KI270727v1_random:228385-228407 CAGGATTACAATAATGTGATAGG + Intergenic
1134425794 16:14142934-14142956 AAGCATTGCAATAATGTAGAAGG + Intronic
1135959233 16:26982028-26982050 CAGAATTACAGTTATGTGGTAGG - Intergenic
1137953055 16:52801915-52801937 AAAGATGCCAATAATGTGGCAGG - Intergenic
1138985919 16:62328394-62328416 AAGGAATAAAATACTGTGCTGGG - Intergenic
1142546853 17:710247-710269 AAGGATTTTTATAATGTAGTAGG - Intronic
1145333284 17:21890959-21890981 AAGGAATACAATAGTATGGAAGG + Intergenic
1146241690 17:31234782-31234804 AAGGATTACAATAATGTGGTAGG - Intronic
1155545688 18:26912251-26912273 AAGGATTACAAAAAAGTTGTGGG + Exonic
1157012093 18:43662052-43662074 AAGGATTACAATTGGTTGGTTGG + Intergenic
1157137973 18:45076125-45076147 AAGGAAAACAATAATGAGTTAGG + Intergenic
1160233228 18:77065046-77065068 GAGGTTTACATTAATGAGGTTGG - Intronic
1162653353 19:12108703-12108725 ATGCATAACAAAAATGTGGTAGG - Intronic
1164801062 19:31077123-31077145 AAGTATAAAAATAATGAGGTGGG - Intergenic
930542974 2:52730689-52730711 AAAGATTAAAAAAATTTGGTCGG - Intergenic
936939076 2:117864461-117864483 AAGGAATAAAATAATGTCTTTGG - Intergenic
939436073 2:142179863-142179885 AAGGGAAACAATAATGTGGTAGG + Intergenic
939444896 2:142296556-142296578 AAAGATTACAGTCAAGTGGTGGG + Intergenic
941033048 2:160534950-160534972 ATAGATAACAATAATGTGTTAGG - Intergenic
942712182 2:178849049-178849071 AAGGATAAAGATAATTTGGTTGG + Intronic
942886240 2:180927435-180927457 AAGGAATAGAGTAATTTGGTGGG + Intergenic
943590475 2:189790100-189790122 CATGATTAAAATAATGTCGTAGG + Intronic
944648353 2:201803335-201803357 AAGAACTCCAAAAATGTGGTAGG + Intronic
944880807 2:204011168-204011190 GTGGATTACAATAAAGTGGCAGG - Intergenic
945112598 2:206377084-206377106 CAGGATTGCAATAATGCGGGGGG + Intergenic
945548599 2:211190107-211190129 AAGAATTAGAATATTTTGGTAGG - Intergenic
946352040 2:219161471-219161493 AAAGATTAAAATAATGCCGTGGG - Intronic
946518550 2:220440513-220440535 AAGCATTAAAAGAATATGGTTGG - Intergenic
948064427 2:235066487-235066509 AAAAATTTCAATAATGTGGCTGG - Intergenic
948823905 2:240565228-240565250 AATGAGTAAAATACTGTGGTTGG + Intronic
1170879549 20:20284038-20284060 AAGGATAAAAAGCATGTGGTAGG - Intronic
1171219083 20:23377917-23377939 TAGGATGAAAATGATGTGGTAGG + Intronic
1173047302 20:39525019-39525041 AATGCTTAGAATAATGTGGTGGG - Intergenic
1173047529 20:39526832-39526854 AGTGCTTAGAATAATGTGGTGGG - Intergenic
1175431302 20:58906122-58906144 AAGCAGTACAATACCGTGGTGGG + Intronic
1176723609 21:10412799-10412821 AAGGTTTGCAAAAATATGGTGGG - Intergenic
1177489950 21:21809818-21809840 AAGTATTAAAATATTGTTGTTGG - Intergenic
1178508529 21:33182581-33182603 AAAGATTACAAGATTTTGGTTGG - Intergenic
1180304767 22:11065572-11065594 AAGGTTTGCAAAAATATGGTGGG - Intergenic
1180916698 22:19493859-19493881 AAGGCCTGGAATAATGTGGTAGG - Intronic
1183861811 22:40675740-40675762 ATGGTTTACAATAATAAGGTGGG + Intergenic
1185272173 22:49934710-49934732 AAGGCTTACTGTAATGTGGCTGG + Intergenic
951913054 3:27771235-27771257 AAAGAGTACAATAATGTGTGCGG + Intergenic
953999566 3:47545036-47545058 AAGGATCACCATATTGTTGTTGG + Intergenic
959140060 3:102474902-102474924 AAGGAATAAAAAAGTGTGGTGGG + Intronic
959412654 3:106044752-106044774 AAGGATTTTAGTAATGTGGTTGG - Intergenic
966613441 3:181890646-181890668 AAGGCTGAGAATAATGTAGTGGG - Intergenic
967612350 3:191522474-191522496 AAGGAGACCAATAAGGTGGTTGG + Intergenic
967696394 3:192536908-192536930 AATGAGTACAAAAATGTAGTTGG - Intronic
970994883 4:22254921-22254943 GAGGATTAAAAAAATGTTGTGGG - Intergenic
973007053 4:45022207-45022229 AAGCATGACAATAATGAGATAGG - Intergenic
973007159 4:45026794-45026816 AAGCATGACAATAATGAGATAGG + Intergenic
974524636 4:63033070-63033092 AAGGATTACAAGAAGAAGGTAGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976495426 4:85724075-85724097 AAGGATTGCAGAAATGTGGTTGG + Intronic
977048125 4:92092028-92092050 AAGGATTACGGAAATATGGTAGG - Intergenic
977201949 4:94127409-94127431 CAGAATTACAAAAATGTTGTAGG + Intergenic
977208827 4:94194520-94194542 AAAGATTACAAAAATTAGGTGGG - Intergenic
977458053 4:97287309-97287331 TAAGATTACAAAAATGAGGTTGG + Intronic
979345913 4:119586890-119586912 GAAGATTAAATTAATGTGGTAGG - Intronic
979923467 4:126529357-126529379 AAGGCTTAAAATAATTTTGTTGG - Intergenic
981096779 4:140790055-140790077 AAGCATGACAATAATGGGGAGGG + Intergenic
981144363 4:141307806-141307828 AAGAAATACAGAAATGTGGTTGG - Intergenic
982617015 4:157651535-157651557 AATGATTGCAATATAGTGGTAGG + Intergenic
983312029 4:166076807-166076829 GAAGATTACAATAAAGTGGAAGG - Intronic
983434715 4:167698419-167698441 AGGGACCACAATAGTGTGGTAGG + Intergenic
985109695 4:186536047-186536069 AAAGATTACACTAGAGTGGTTGG + Intronic
985861667 5:2476404-2476426 AAAGATTACAAGAAGGTGGAAGG + Intergenic
986077376 5:4351947-4351969 ATGGATAACAAAAATGTGGTAGG + Intergenic
986387907 5:7255096-7255118 AGGGATTAGAATAGTGTGGCTGG - Intergenic
989792076 5:45417274-45417296 AAACATTACATTAATGTAGTAGG - Intronic
991312081 5:65254907-65254929 TATGATTACAATAATATGTTTGG + Intronic
991527996 5:67583957-67583979 AATGATTATAACAATGTTGTAGG + Intergenic
992303264 5:75406839-75406861 AAGACTTACCATAATGTGGCTGG - Intronic
993050051 5:82916115-82916137 AACAATTACCATTATGTGGTAGG - Intergenic
993282261 5:85939563-85939585 TAGGATTACAATATTATCGTAGG - Intergenic
995239153 5:109866038-109866060 AAAGATAAGAAAAATGTGGTAGG + Intronic
999099104 5:149007746-149007768 AAGGCTTACAATCATGTCTTTGG + Intronic
1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG + Intergenic
1004917394 6:20344717-20344739 AAGGATTACAGCAATGAGATCGG - Intergenic
1006245570 6:32731502-32731524 TAGCATTACAAGAATCTGGTAGG + Intergenic
1007100098 6:39240119-39240141 AAGGATAACATTAAGGTGGCTGG - Intergenic
1009614799 6:65990669-65990691 CAGGATTACAGTAATCTGGCCGG + Intergenic
1012652468 6:101772941-101772963 AACAAATACAATTATGTGGTTGG - Intronic
1013826652 6:114219208-114219230 AAGAATAAAAATAATGTGATTGG - Intronic
1014337754 6:120159232-120159254 AAGAATTATGATAATTTGGTAGG - Intergenic
1015151130 6:130039422-130039444 ATGAATTACAATATTGTGATTGG + Intronic
1015706148 6:136089931-136089953 AAAGATTACATTCCTGTGGTGGG - Intronic
1016173169 6:141044907-141044929 AAGGATAAAGAAAATGTGGTAGG - Intergenic
1016295510 6:142569182-142569204 AAGGAAGACTATAATGTGGTTGG - Intergenic
1016760040 6:147726777-147726799 AAGGATTCCAAGAAAGAGGTGGG + Intronic
1017113536 6:150954775-150954797 AAAGAATACAAAAATGAGGTGGG - Intronic
1020258376 7:6515615-6515637 AAAAAATACAAAAATGTGGTAGG + Intronic
1021760614 7:23900089-23900111 AAGATTTACAATCATATGGTTGG + Intergenic
1022150391 7:27597496-27597518 CAGGCTTAGAATAATGTGCTGGG + Intronic
1024330370 7:48148907-48148929 AAAGATTACTATAATTTGATTGG + Intergenic
1024609095 7:51047862-51047884 AAGCATTTCAATAATTTTGTGGG + Intronic
1026212368 7:68317080-68317102 AAGGATTAAAAATATGTGGGAGG - Intergenic
1030499365 7:110340117-110340139 AAAAATTACTATAATGTGCTGGG - Intergenic
1031341534 7:120608697-120608719 AATGATTACTATACTGTGGTTGG - Intronic
1031342700 7:120623801-120623823 AAGAATTACAAAAATGTGAATGG + Intronic
1031676383 7:124617030-124617052 AAGGATCACAATGATGTTTTGGG - Intergenic
1032164671 7:129536111-129536133 AATGGTTACAATTTTGTGGTAGG + Intergenic
1032582149 7:133113320-133113342 AAGGATGCCAACAGTGTGGTTGG - Intergenic
1037074163 8:14692705-14692727 AAGGATTCCAATAATTTAGGTGG - Intronic
1041508851 8:58632354-58632376 AGTGATTTCAATAATATGGTAGG - Intronic
1044122126 8:88410956-88410978 AAGGCTCACAATGATGTGGGTGG + Intergenic
1045190176 8:99874103-99874125 AGGGATTTCAATAATGTGCCAGG - Intronic
1046882272 8:119322097-119322119 AAGGTTTAGAATAATGTAGAAGG + Intergenic
1048726245 8:137388212-137388234 AAAGATTAGAATAGTGTGGAGGG - Intergenic
1051976785 9:22959802-22959824 GTTGAGTACAATAATGTGGTAGG + Intergenic
1052247951 9:26361253-26361275 CAGTAGTGCAATAATGTGGTAGG + Intergenic
1054331726 9:63764226-63764248 AAGCATGACAATAATGAGATAGG - Intergenic
1055241062 9:74186966-74186988 AATGATTGCAATAATCTGATTGG - Intergenic
1056908766 9:90678625-90678647 AAGGATTAAAATAATCTATTTGG + Intergenic
1057962195 9:99467594-99467616 GATGAATACAAAAATGTGGTGGG + Intergenic
1058752134 9:108050036-108050058 GAGGATTAAAATAAGGTGATAGG + Intergenic
1060413686 9:123416081-123416103 AGGGACTACAACAGTGTGGTTGG + Intronic
1202799100 9_KI270719v1_random:157226-157248 AAGCATGACAATAATGAGATAGG - Intergenic
1185894485 X:3845278-3845300 AATGTTTACAAGAATGTGGTAGG + Intergenic
1185899603 X:3883702-3883724 AATGTTTACAAGAATGTGGTAGG + Intergenic
1185904719 X:3922131-3922153 AATGTTTACAAGAATGTGGTAGG + Intergenic
1187628317 X:21141629-21141651 AAGGATTGCACAGATGTGGTAGG + Intergenic
1187775929 X:22757392-22757414 GAGAATTATAATAATGTGATAGG - Intergenic
1188804025 X:34565290-34565312 AAGTATTACAAGAATGAGATAGG - Intergenic
1189019978 X:37325296-37325318 AAGGATTGCATTAAAGTTGTAGG - Intergenic
1191853081 X:65600591-65600613 AGGAATTACCATAATGTGTTTGG + Intronic
1194063762 X:89237407-89237429 ATGGACTAGAATATTGTGGTAGG + Intergenic
1200717934 Y:6571513-6571535 ATGGACTAGAATATTGTGGTAGG + Intergenic
1201561777 Y:15324793-15324815 AAGAATTACAGCAATGTGCTGGG + Intergenic