ID: 1146242671

View in Genome Browser
Species Human (GRCh38)
Location 17:31244541-31244563
Sequence CAGAGCTCAGCTGGTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 2, 1: 4, 2: 5, 3: 69, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146242671_1146242675 4 Left 1146242671 17:31244541-31244563 CCTTGAGCACCAGCTGAGCTCTG 0: 2
1: 4
2: 5
3: 69
4: 309
Right 1146242675 17:31244568-31244590 GTGTTGCTTTCTGCTATGACAGG 0: 5
1: 46
2: 144
3: 248
4: 535
1146242671_1146242676 5 Left 1146242671 17:31244541-31244563 CCTTGAGCACCAGCTGAGCTCTG 0: 2
1: 4
2: 5
3: 69
4: 309
Right 1146242676 17:31244569-31244591 TGTTGCTTTCTGCTATGACAGGG 0: 4
1: 61
2: 158
3: 269
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146242671 Original CRISPR CAGAGCTCAGCTGGTGCTCA AGG (reversed) Intronic