ID: 1146247626

View in Genome Browser
Species Human (GRCh38)
Location 17:31303608-31303630
Sequence GGGGGCACAAATTTTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146247626_1146247628 -10 Left 1146247626 17:31303608-31303630 CCAGTTTTAAAATTTGTGCCCCC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1146247628 17:31303621-31303643 TTGTGCCCCCCCAACATGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146247626 Original CRISPR GGGGGCACAAATTTTAAAAC TGG (reversed) Intronic
902866469 1:19283384-19283406 AGGGGCAGACATTTTAACACAGG - Intronic
904297649 1:29531870-29531892 GGGGGCAGAAATCTGAACACTGG + Intergenic
905013749 1:34763316-34763338 GGTGGAAGAAATTTTAAAGCAGG - Exonic
906896181 1:49774591-49774613 AGAATCACAAATTTTAAAACTGG - Intronic
907911084 1:58826691-58826713 TGGGCCAGAGATTTTAAAACAGG - Intergenic
908082886 1:60599248-60599270 AGGGGCACAATTTTTATAGCAGG - Intergenic
912125831 1:106536681-106536703 GGTGGCAAAAATGTTAAAAATGG - Intergenic
912176358 1:107162654-107162676 GGGGCAACAAATTTTAAGAGTGG + Intronic
914359547 1:146921471-146921493 GATGGCATCAATTTTAAAACTGG - Intergenic
914494202 1:148178404-148178426 GATGGCATCAATTTTAAAACTGG + Intergenic
914769758 1:150673626-150673648 GGGAGCAAAAATTTGAAAACAGG + Intronic
916145461 1:161735214-161735236 TGGGTCCCAAATTTTAAAACTGG - Intergenic
916771660 1:167914771-167914793 AGGGGCACAGCTTTTAAAATTGG + Intergenic
916937908 1:169649100-169649122 TGGGGATCAAATTTTAACACAGG + Intergenic
918633976 1:186752959-186752981 TGGGGCACATATGTAAAAACTGG + Intergenic
923371695 1:233320921-233320943 GGAAGCTCAAATTTTAACACTGG + Intergenic
1066291509 10:34018389-34018411 GGTAGCCCAAAGTTTAAAACTGG + Intergenic
1068964986 10:62902842-62902864 GGGGGGATAATTTTTAAAATGGG - Intronic
1069813271 10:71178146-71178168 AGAGTCACAAATATTAAAACAGG + Intergenic
1071403283 10:85299852-85299874 AGGAGCACAAAATGTAAAACGGG - Intergenic
1071591482 10:86878402-86878424 TTGGTCACAAATTTTACAACAGG + Intronic
1071868359 10:89763592-89763614 AGAGGCCCAAATTTTAACACTGG - Intronic
1074512087 10:114122932-114122954 GGTAGCACAAATATTAATACTGG + Exonic
1078058595 11:8029341-8029363 GAGGGCCCAAACTTTAAAAGTGG - Intronic
1079275414 11:19031441-19031463 TGGGGGACAAATATTAAAAAAGG + Intergenic
1080280779 11:30554422-30554444 CAGAGCAAAAATTTTAAAACAGG - Intronic
1080596233 11:33776364-33776386 TGGGGCACAAATTTAAGAAGAGG + Intergenic
1081147927 11:39586253-39586275 AGGGGAACAAATTTTTAAGCTGG - Intergenic
1081943406 11:46965022-46965044 GAGTGCACAAATTTTAAGACTGG + Intronic
1082628386 11:55512239-55512261 GGGGGCAGTAATCTTGAAACTGG - Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1086200647 11:84197413-84197435 TGGAGAACAAATTTTAAAAATGG - Intronic
1088032836 11:105273025-105273047 GAGGGCACTAATTTTCAAAGAGG + Intergenic
1096821442 12:54238650-54238672 GGGAGCACCCATTTTAAACCTGG - Exonic
1099870245 12:88338992-88339014 GGAGGCCCAAAGTTTAAAAGAGG - Intergenic
1100717618 12:97322347-97322369 GGAGGCAGAAAATTCAAAACAGG + Intergenic
1101146426 12:101844952-101844974 GGAGGCACAGAAGTTAAAACAGG - Intergenic
1102910087 12:116707092-116707114 GGGGTCACAAAGTTTAACCCAGG + Intergenic
1108553037 13:51565423-51565445 GGCGGCACATATTCTAAAATTGG + Intergenic
1109211963 13:59545364-59545386 GGGGTTACAGATCTTAAAACAGG + Intergenic
1116733501 14:48657393-48657415 GGGGAGTCAAATTTTAAAAGAGG + Intergenic
1116892113 14:50279019-50279041 GTGGGAACTAATTTTAAAAATGG - Intronic
1117098399 14:52320639-52320661 AGGGTCAGAAATTTCAAAACAGG - Intronic
1120534513 14:85677231-85677253 GGGTGCTTAAATTTTAAGACTGG + Intergenic
1127923146 15:63510255-63510277 AGGGACTCAAATTTTAAAACAGG - Intronic
1133839852 16:9397865-9397887 AGGGACTCAAATTTTAAAACAGG - Intergenic
1138321463 16:56116957-56116979 GCAGGAACAAAGTTTAAAACAGG + Intergenic
1138622484 16:58223027-58223049 TGGGGAGCAAATTTTAAAAATGG - Intergenic
1142717339 17:1754472-1754494 GGGGGCACAAGTTTTAAGTCAGG - Exonic
1143708912 17:8719976-8719998 AGGGCCATAAATTTTCAAACTGG + Intergenic
1143806604 17:9433686-9433708 GGGGTCACAGATATTAAAACGGG + Intronic
1145256093 17:21323288-21323310 GGGAGCACAAACTTTAAAGCGGG + Intergenic
1145320520 17:21764662-21764684 GGGAGCACAAACTTTAAAGCGGG - Intergenic
1145968353 17:28937841-28937863 GGGTGCAAACATTTTAAAAAGGG + Intronic
1146247626 17:31303608-31303630 GGGGGCACAAATTTTAAAACTGG - Intronic
1146372805 17:32275812-32275834 GGGAGCAGAAATAATAAAACTGG + Intronic
1148435452 17:47680859-47680881 GAGAGCAGAACTTTTAAAACTGG + Intronic
1149570480 17:57668790-57668812 GGGGGAAAATACTTTAAAACTGG - Intronic
1149748055 17:59118630-59118652 GGGGAGACAGAATTTAAAACAGG - Intronic
1150525568 17:65918920-65918942 AGGGGCTCAAAAATTAAAACTGG + Intronic
1156478598 18:37422074-37422096 GGGGCAACAAATTATAACACTGG + Intronic
1159604275 18:70458630-70458652 AGGAGCACAGATTTTAAAAAAGG - Intergenic
1161084619 19:2329019-2329041 GGGGGCACAAATTTCAGACCCGG - Intronic
1162827317 19:13261269-13261291 GGTGACTCAAATTCTAAAACCGG + Intronic
1165290469 19:34880244-34880266 GGTGGCAGAAATTTAAAAGCTGG - Intergenic
1167026920 19:46926760-46926782 GGGGACACAAACTGTCAAACTGG - Intronic
1167436729 19:49482923-49482945 GGGGTCACAGTTTTTAAAAAAGG + Intronic
925720077 2:6818524-6818546 GAGGTCACACATGTTAAAACTGG - Intergenic
926760210 2:16271795-16271817 GGGGGAACTAATTATAAAAGTGG - Intergenic
927034331 2:19157849-19157871 GAAGGCACAAATTTTTACACTGG - Intergenic
927536369 2:23863611-23863633 GGGGGGACATTTTTTAAAATTGG - Intronic
931089080 2:58866490-58866512 GGGGATATAAATTTTAAATCTGG + Intergenic
933817317 2:86078865-86078887 AGGGGCAAAAATATTAAAAAAGG - Intronic
937030731 2:118737883-118737905 GGGAGCAGTATTTTTAAAACTGG + Intergenic
939867919 2:147495511-147495533 GGCGGCACATATACTAAAACTGG - Intergenic
940617408 2:156066541-156066563 GGGGACACAAATTTTAAGGCAGG - Intergenic
940747187 2:157581135-157581157 GGAGGAACAAATTTTAAATACGG + Intronic
946087575 2:217189520-217189542 GGAGGCACAGTTTTCAAAACTGG + Intergenic
946385155 2:219379596-219379618 GGAGTCAAAAATTTTAAAAATGG + Intronic
947063339 2:226191555-226191577 GTGTGCACATATTTTAAAACAGG + Intergenic
1169881655 20:10353261-10353283 GGGAGCAAAAATTTAAAGACAGG + Intergenic
1171067686 20:22034519-22034541 GGGGGGCCAAGTTTTAGAACTGG - Intergenic
1172403197 20:34667779-34667801 GTAGGCAAAAATTTAAAAACAGG + Intronic
1172854742 20:37993220-37993242 GGGGGCATAAATCTTCCAACTGG - Intronic
1174035803 20:47667633-47667655 GTGGGCAGAGGTTTTAAAACAGG - Intronic
1174341735 20:49901360-49901382 GTGGCCACAGATTTGAAAACCGG + Intergenic
1175126780 20:56758222-56758244 GGATGCACAAAATTTGAAACTGG - Intergenic
1175313765 20:58031132-58031154 GGAGGAACACATTTTAACACTGG + Intergenic
1179340265 21:40501444-40501466 GGGAGCATAATTTTTAAAAATGG - Intronic
950717460 3:14859712-14859734 AGGGGTACAAAGTTTCAAACAGG - Intronic
952485777 3:33808247-33808269 GGGGCAACTAATTTTAAAAAGGG + Intronic
952643300 3:35624584-35624606 GGGGACACAAATATTACAGCCGG + Intergenic
953509988 3:43525763-43525785 AGAGGAACAAATTTGAAAACTGG - Intronic
953936266 3:47046031-47046053 GGCTACACAAATTTAAAAACGGG + Intronic
956889862 3:73602007-73602029 GGGTGCACAATTTGTACAACAGG + Intronic
965659919 3:171030217-171030239 GGGGGCACCCATTTTAGAAAAGG + Intergenic
966122300 3:176536410-176536432 GAGTGCACAAATTTTGAAAGTGG + Intergenic
968443370 4:635822-635844 GGGGGCACATGTCTGAAAACTGG + Intronic
968847219 4:3051370-3051392 GGGGGCACCAAATATCAAACTGG - Intergenic
970973382 4:22012970-22012992 TGTGGCATAAATTTTAAAATGGG - Intergenic
972456054 4:39256554-39256576 TGGGGCACATATTTCAAAACTGG - Intronic
978921618 4:114190238-114190260 GGAGGCTGAAATTTTAGAACAGG - Intergenic
982143203 4:152351043-152351065 GTGGACACAAATCTTAAAAAGGG - Intronic
982828785 4:160032641-160032663 GGAGTCACAAATTTTAAGGCAGG + Intergenic
983122116 4:163899211-163899233 GGGGGAACAAATTTAAGAAAAGG - Intronic
983152304 4:164299792-164299814 GGTGGCACTAATATAAAAACAGG + Intronic
984611585 4:181845629-181845651 GCAGGCAGAAATTTTATAACTGG - Intergenic
985915246 5:2913266-2913288 GGGGACACAATTTGTAAACCTGG - Intergenic
988143941 5:27279805-27279827 GGTGGCACCTATTTTATAACAGG - Intergenic
988676247 5:33435897-33435919 GTGGGCATAAATTATAACACTGG + Intergenic
989404313 5:41043204-41043226 GGGGGCATAAAGTTAAAAAGAGG + Intronic
990780896 5:59361873-59361895 AGGGGCAGAAATTTCAGAACAGG + Intronic
991384142 5:66065778-66065800 GGGGGAACAACTTTAAAAGCTGG + Intronic
992061955 5:73060543-73060565 TGGGGGACAAAGTTTAAGACTGG - Intronic
993230033 5:85223567-85223589 AGAAACACAAATTTTAAAACAGG + Intergenic
994928468 5:106149421-106149443 GGAGGCTCAAATTTTATCACTGG - Intergenic
995240312 5:109877948-109877970 GGGGGAAAAAAGTTTTAAACAGG + Intergenic
996060920 5:119032334-119032356 GGGGGTTAAAATTTTAAAAAGGG - Intergenic
996786918 5:127247794-127247816 GGGGGCAGAAATGGTAACACAGG + Intergenic
1002152296 5:177244369-177244391 TGAGGTACAAGTTTTAAAACTGG + Intronic
1008340235 6:50355477-50355499 GGGGAAAAAAATTCTAAAACCGG + Intergenic
1011223633 6:85084038-85084060 TGTGGCACTAATTATAAAACAGG - Intergenic
1011290464 6:85771806-85771828 GTGGACACAAGTTTTAAAGCAGG + Intergenic
1013384101 6:109607095-109607117 GGAGGCACAGTTTTTAAAATGGG + Intronic
1016494564 6:144645714-144645736 AGGAGAACAAATTTTAAAAGTGG + Intronic
1017033633 6:150247396-150247418 GTGGCCAAACATTTTAAAACAGG + Intronic
1017607928 6:156153180-156153202 GGGAACAAAAATCTTAAAACTGG - Intergenic
1018638330 6:165884262-165884284 AGAGGCACACATTTTAAAAACGG + Intronic
1019695699 7:2445033-2445055 GGGGGCACAGATTTGCAAAGTGG + Intergenic
1020626303 7:10584172-10584194 GGAGCCACAAATTTCCAAACAGG + Intergenic
1024968758 7:55049810-55049832 GGGGGCACATTCTTTAAAATTGG + Intronic
1027756725 7:82223350-82223372 GGGGAAACAAATTTTAAGACTGG - Intronic
1028583511 7:92430729-92430751 GGGGGAACAAATATTAAATGTGG + Intergenic
1028803449 7:94995733-94995755 ATGGGCACAAATTTTAGAAATGG - Intronic
1031839779 7:126724012-126724034 GAGGGCATACATTTTTAAACAGG + Intronic
1033505762 7:141998085-141998107 GGGGGCCCAAATTATTAAAATGG - Intronic
1035557098 8:575617-575639 GTGGGCACCAATTTGAAACCTGG + Intergenic
1041974361 8:63780183-63780205 GGAGGCAGGAATTTTCAAACAGG + Intergenic
1044663939 8:94617331-94617353 GGGAAAACAAAATTTAAAACAGG + Intergenic
1047326465 8:123842072-123842094 GTAGGCAAATATTTTAAAACAGG + Intergenic
1048900019 8:139028136-139028158 GGGGGGATAAAATTTAACACTGG - Intergenic
1052909414 9:33867014-33867036 GGGGACAAAAGTTTTAAAATAGG - Intronic
1056243782 9:84673788-84673810 GTGGGCAAAAAATATAAAACAGG - Intronic
1060902879 9:127276493-127276515 GGAGTCACCAATTTTAAGACAGG - Intronic
1187966143 X:24614276-24614298 GGGGGTACAAATTCTAGAAGAGG - Intronic
1195110430 X:101642609-101642631 GCTGGCAAAAATTTTAAAGCTGG - Intergenic
1197797153 X:130310145-130310167 GGGAGCACATATATTAAAATTGG - Intergenic
1197892817 X:131282850-131282872 GGGAGCAGAATTTGTAAAACTGG - Intronic
1198501825 X:137257260-137257282 GGGTTCACAAATTTGAAAAAGGG - Intergenic
1199116055 X:143994119-143994141 GGAGACACAAAGTTTAACACTGG + Intergenic
1199179521 X:144836833-144836855 GGAGGCACAGATTTTATAAAAGG + Intergenic
1199314336 X:146359405-146359427 GGTGACACAAATTTAAAAGCTGG + Intergenic