ID: 1146251241

View in Genome Browser
Species Human (GRCh38)
Location 17:31345942-31345964
Sequence TCAATACCATGTACATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 2, 2: 0, 3: 3, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146251241_1146251245 12 Left 1146251241 17:31345942-31345964 CCACCTCATGTACATGGTATTGA 0: 2
1: 2
2: 0
3: 3
4: 92
Right 1146251245 17:31345977-31345999 TGAACCATTAGTCCAGCAGGAGG 0: 4
1: 1
2: 1
3: 5
4: 70
1146251241_1146251244 9 Left 1146251241 17:31345942-31345964 CCACCTCATGTACATGGTATTGA 0: 2
1: 2
2: 0
3: 3
4: 92
Right 1146251244 17:31345974-31345996 TGGTGAACCATTAGTCCAGCAGG 0: 4
1: 2
2: 0
3: 18
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146251241 Original CRISPR TCAATACCATGTACATGAGG TGG (reversed) Intronic
910317953 1:85909754-85909776 TCAAAAGCATGTAAATGAGATGG - Intronic
911630286 1:100175591-100175613 GGAATACCATGTACATTAGTGGG + Intronic
917345825 1:174027350-174027372 TAAACACCATGTAATTGAGGAGG + Intergenic
918864742 1:189881109-189881131 TAACTACCATATAAATGAGGAGG + Intergenic
1066695447 10:38073306-38073328 TCTAAACCATAAACATGAGGGGG - Intergenic
1068993990 10:63181313-63181335 AAAATAACAAGTACATGAGGCGG + Intronic
1072030046 10:91510395-91510417 TCAATAACATGTATTTGATGAGG - Intronic
1075571632 10:123550696-123550718 TCATTAGCATGTAAATGATGCGG + Intergenic
1076450167 10:130551703-130551725 ACCATACCATGGACAGGAGGCGG + Intergenic
1079242625 11:18731496-18731518 TCAATGCCATGGAGATGATGAGG - Intronic
1079924261 11:26473183-26473205 TCAAGACCATATACATTAAGTGG + Intronic
1081498853 11:43645305-43645327 ACAATACCATGGAAATAAGGCGG - Intronic
1082899150 11:58227123-58227145 ACAACCCCATGTACATGAAGAGG + Intergenic
1084656729 11:70523967-70523989 TGAATACCTGGCACATGAGGGGG + Intronic
1085740805 11:79076808-79076830 ACAGTACCAAGCACATGAGGAGG - Intronic
1086036454 11:82420952-82420974 TAAATACCAGGTAAAGGAGGTGG - Intergenic
1092968377 12:13668079-13668101 TCAATAACATTTAAATGAGATGG + Intronic
1094567785 12:31615994-31616016 TCAATACCATGTACATGAGGTGG + Intergenic
1095375502 12:41523296-41523318 TCAACAGCATCTACATGAGAGGG - Intronic
1096612455 12:52811750-52811772 TCAAGACTAAGTACATGGGGAGG - Exonic
1096648077 12:53048918-53048940 TAAATACCATGCAAATGAGAGGG + Intronic
1099177560 12:79439347-79439369 TCATTACCACCTATATGAGGTGG - Intronic
1099623984 12:85044281-85044303 TTATTACCATGTAAATGAAGAGG - Intronic
1101579589 12:106030903-106030925 TCAGTACCATATACAGTAGGAGG + Intergenic
1106191539 13:27457933-27457955 TCATCACAATGTACAAGAGGAGG - Intergenic
1116990667 14:51272900-51272922 ACAATAGCATGTAAATTAGGAGG - Intergenic
1119255249 14:73190029-73190051 TGAGTACAATGTACATAAGGAGG - Intronic
1129268513 15:74407588-74407610 TAAATTCCATGTAAATGAGCTGG - Intergenic
1130639928 15:85662991-85663013 TCAATACCAGGGATAAGAGGAGG - Intronic
1133616602 16:7482838-7482860 TGAACACCATGTACAGGAGATGG + Intronic
1139017683 16:62709948-62709970 TTACTACCATGAGCATGAGGTGG + Intergenic
1146251241 17:31345942-31345964 TCAATACCATGTACATGAGGTGG - Intronic
1151234915 17:72712974-72712996 TCAAGACCCTGCAGATGAGGGGG + Intronic
1155292635 18:24356914-24356936 TGCTTACCATGTACCTGAGGTGG - Intronic
1164644787 19:29850526-29850548 TCTATACCATGTTCATGAATTGG + Intergenic
1164644876 19:29851367-29851389 TCTATACCATGTTCATGAATTGG - Intergenic
1168103608 19:54153770-54153792 TCCACACCAAGTACATGATGTGG + Exonic
1168581250 19:57557489-57557511 TCTCTACCATCTCCATGAGGGGG - Intronic
925667114 2:6270232-6270254 TCAATCCCATGTTAATCAGGAGG + Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
930457839 2:51629201-51629223 TCAATACAAACTACATGACGAGG + Intergenic
937684339 2:124679332-124679354 TCAATGCAATGAAAATGAGGAGG - Intronic
943434058 2:187841385-187841407 TCCATACAATGTACAAGCGGTGG - Intergenic
944260565 2:197671410-197671432 ACAATACAAGGTACATGTGGAGG - Intronic
946226733 2:218267856-218267878 CCAATGCCATGGACAAGAGGTGG + Intronic
946591122 2:221248839-221248861 ACAATTCCATGTAGCTGAGGAGG + Intergenic
1170477689 20:16732227-16732249 TAAAGACCATGAAGATGAGGGGG + Exonic
1171353726 20:24526492-24526514 ACAATAGCATGTAAATCAGGAGG - Intronic
1173047205 20:39523922-39523944 TCAATACCATTTTGTTGAGGGGG + Intergenic
1173567507 20:44052225-44052247 TCCCTACCATGTTCTTGAGGAGG - Intronic
1182115738 22:27755296-27755318 GCAATACCATGTGCATGTTGGGG + Intronic
1183758412 22:39792393-39792415 ACAATAGCATGTAACTGAGGAGG - Intronic
950080737 3:10220265-10220287 TCAGTGCCATGCACATGAGAGGG + Intronic
956059207 3:65332866-65332888 TCATTACAGTGTACATGTGGTGG - Intergenic
956820542 3:72950006-72950028 TCAATCCCATTTACAGGAAGAGG + Intronic
957997943 3:87714982-87715004 TAAAAACCACATACATGAGGTGG + Intergenic
958689598 3:97446682-97446704 TCAATCTCATATACAAGAGGAGG - Intronic
960203383 3:114865530-114865552 TCAAATCCATGTATAGGAGGTGG - Intronic
963283788 3:143413080-143413102 TCAATAACATCACCATGAGGTGG - Intronic
964435334 3:156645451-156645473 TCAAAACCCTGGATATGAGGAGG + Intergenic
965109714 3:164405113-164405135 ACAATATGATGTACATAAGGAGG - Intergenic
965299091 3:166987924-166987946 ACAATACAATGTACATGTGTAGG - Intergenic
965800050 3:172483145-172483167 TGAATACCATGATCATAAGGTGG - Intergenic
967712593 3:192726721-192726743 GAAATACCATCTTCATGAGGTGG + Intronic
970822830 4:20239080-20239102 GCAAAACCATCTACATGAGCTGG - Intergenic
976239035 4:82933883-82933905 TCAATGCCATATACATGAAAGGG + Intronic
979862754 4:125715127-125715149 TGAATACCAGGAACATGATGGGG - Intergenic
981968628 4:150637446-150637468 TCAAGACCATGAACACTAGGAGG - Intronic
982001784 4:151027376-151027398 TCAATACCATGAACATGAGGTGG - Intergenic
985018559 4:185662544-185662566 TCAGTACCAAGTAAATGTGGAGG + Intronic
990334601 5:54759741-54759763 TGAATATTATGTGCATGAGGAGG - Intergenic
990412149 5:55552108-55552130 TCAATCCCATGTACATGAGGTGG + Intergenic
994198300 5:96943682-96943704 TCCTTAACATGTAAATGAGGAGG + Intronic
999750223 5:154622827-154622849 TCAATGTCATGAAAATGAGGTGG + Intergenic
1007234377 6:40379750-40379772 ACAAGACCATGTACAAAAGGGGG - Intergenic
1007698369 6:43748195-43748217 TCATGACCATGAACATGAGAAGG - Intergenic
1008846746 6:55975530-55975552 ACAACACCATCTACATGAAGTGG - Intergenic
1009741331 6:67750467-67750489 TCAATACCATATAAAAGATGTGG + Intergenic
1009924933 6:70109224-70109246 TCATTACCATCTAATTGAGGTGG + Intronic
1010082058 6:71875036-71875058 TGTATAGCATGAACATGAGGTGG - Intergenic
1010272772 6:73933325-73933347 TTAATCCCATGTACCTGAGCTGG + Intergenic
1011993864 6:93559860-93559882 TCAATGCCATGGACAGGAGGGGG + Intergenic
1012262836 6:97108041-97108063 TCATTTCCATGTACAACAGGAGG - Intronic
1017035211 6:150261103-150261125 TAAATACCATGGACAGGTGGAGG - Intergenic
1017980776 6:159399544-159399566 TTAATACCATTTCCCTGAGGTGG - Intergenic
1018562923 6:165120996-165121018 TCAACACAATGTACCTTAGGAGG + Intergenic
1020286683 7:6687172-6687194 ACAATACCATTTACATGAGAAGG - Intergenic
1020805651 7:12787004-12787026 TCAATACCTTGTAAATGTGATGG - Intergenic
1023389016 7:39689327-39689349 TTAATAGCATGTAAATGTGGTGG + Intronic
1026778082 7:73244092-73244114 TCACTACCACGTCCATGACGTGG + Intergenic
1027018935 7:74797486-74797508 TCACTACCACGTCCATGACGTGG + Exonic
1027069095 7:75148451-75148473 TCACTACCACGTCCATGACGTGG - Exonic
1027188070 7:75983592-75983614 CCAATTCCAGGTGCATGAGGTGG - Exonic
1027851492 7:83458230-83458252 TCAATATCATGTGTATGAAGTGG + Intronic
1036924319 8:12889443-12889465 TCAATACCATGTCTCTGAGATGG - Intergenic
1049809738 8:144560722-144560744 TGAATATCATGTTCCTGAGGCGG + Intronic
1050458392 9:5856001-5856023 TCAATCCCATGTACACCAGGTGG + Intergenic
1190682071 X:52834978-52835000 TCAGTTCCATGTAAATGAAGGGG + Intergenic
1191687474 X:63906909-63906931 TCAATACTATGTAGAATAGGAGG - Intergenic