ID: 1146253589

View in Genome Browser
Species Human (GRCh38)
Location 17:31374042-31374064
Sequence CTGTTACAGTGGCCAGTGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146253589_1146253593 -5 Left 1146253589 17:31374042-31374064 CCTACCACTGGCCACTGTAACAG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1146253593 17:31374060-31374082 AACAGTGGACGAACTCGCCACGG 0: 1
1: 0
2: 1
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146253589 Original CRISPR CTGTTACAGTGGCCAGTGGT AGG (reversed) Exonic
900179823 1:1306180-1306202 CTGTTACAGGAGCCAGTTATGGG - Intronic
901961086 1:12827183-12827205 CTGTTACAGTGAACACTAGTGGG - Intronic
902379697 1:16046905-16046927 CTGTTCCAGTGGCCAGTGCCAGG + Intronic
902393717 1:16120713-16120735 GTGTTACAGGAGCCAGAGGTTGG - Intergenic
903375017 1:22860417-22860439 ATGATACAGTGCCCGGTGGTGGG + Intronic
903561135 1:24228761-24228783 CTGTTACAGTGATCTGTGATCGG - Intergenic
903795373 1:25924951-25924973 CTGTTACAGTGGTCAGAGACTGG - Intergenic
903878393 1:26491916-26491938 CTCTGACTGTGGTCAGTGGTGGG - Intergenic
904756816 1:32772439-32772461 CAGGTACAGTGGGCAGTGCTAGG + Exonic
905998353 1:42401735-42401757 CTCTTTCAGTGGCTAATGGTAGG + Intronic
913488444 1:119355701-119355723 CTGTTAAACTGGCAAGTGGCTGG - Intergenic
915004785 1:152625931-152625953 GTATTGCAGTGGTCAGTGGTGGG - Intergenic
915589906 1:156864798-156864820 CTGTGAGTGTGGCCAGTGCTGGG + Exonic
916427698 1:164697193-164697215 CTGTTACACTGACCAGTAGAGGG + Intronic
916879007 1:169000710-169000732 CTGTTACATGGACCAGTGTTTGG - Intergenic
917174271 1:172214846-172214868 CTTTTACAGCTGCCAGTGGAGGG + Intronic
917923212 1:179767749-179767771 CTGTTACATTGACCTGTGTTGGG - Intronic
921806767 1:219463820-219463842 TTGTTCCAGTTCCCAGTGGTCGG - Intergenic
924467485 1:244311778-244311800 CAGGAGCAGTGGCCAGTGGTGGG - Intergenic
1063054927 10:2494695-2494717 TTGTGACAGTGGCCAGGGATGGG + Intergenic
1063468690 10:6266522-6266544 GTGTTTCAGTGGCCAGAGTTGGG + Intergenic
1067556644 10:47277751-47277773 ATGTGACAGTGGCTGGTGGTTGG - Intergenic
1070159534 10:73857784-73857806 CTGGGAGTGTGGCCAGTGGTGGG - Intronic
1072084284 10:92063415-92063437 CTGTAACAGAGGCCAGTCTTTGG - Intronic
1075077157 10:119359179-119359201 CTGTGCCAGAGGCCAGGGGTGGG + Intronic
1076701665 10:132276345-132276367 CTGTTCCAGTGCCCAGTGCCAGG - Intronic
1078423367 11:11230171-11230193 CTGGTACAGTGGGCATTGGTTGG + Intergenic
1082137661 11:48568037-48568059 CTAATACAGTGGCCAGAGGAGGG - Intergenic
1082924083 11:58527590-58527612 CTGATACAACGGCCAGTGATGGG + Exonic
1083881763 11:65552404-65552426 CTGCTGCAGGGGCCAGTGGGGGG + Exonic
1084689709 11:70718014-70718036 CTGGTACAGTGGGAAGTGGAAGG - Intronic
1087640047 11:100746775-100746797 GTGTTAGAGTTGCTAGTGGTAGG + Intronic
1090195450 11:124812562-124812584 GTGTTACAGTGGCCCAGGGTGGG - Intergenic
1096215473 12:49795706-49795728 CTGCTCCAGTGGCCTGTGGATGG + Exonic
1097345751 12:58490020-58490042 CTCTTACATTTGCCAGAGGTGGG - Intergenic
1098955222 12:76682407-76682429 CTCTTTCAGTCGCCACTGGTTGG - Intergenic
1099093242 12:78339946-78339968 TGATTACAGTGGCCAGTGGAAGG + Intergenic
1106412796 13:29522977-29522999 CTGTTCCAGTGGCCAGATTTAGG + Intronic
1107079322 13:36357362-36357384 CTGGTACAGAGGCGAGTTGTTGG + Intronic
1107328279 13:39268964-39268986 CTATTACAGTGTCCAGGGGAAGG + Intergenic
1108244872 13:48504155-48504177 CTGTTACAGGGGCCAGATGTGGG - Intronic
1112300123 13:98222597-98222619 CTGTGACAGGTGCCAGTGGAGGG + Intronic
1113235735 13:108270576-108270598 CTGTTACATTTGCCAGCGCTGGG - Intronic
1113869409 13:113549023-113549045 TTGTTACTGTGGCCCGGGGTTGG + Intronic
1115619507 14:35127470-35127492 TAATTACAGTGGCCAGTGTTCGG + Exonic
1116144266 14:41043502-41043524 CTGTTACGGTGATCTGTGGTTGG - Intergenic
1118776618 14:68978021-68978043 CGGGCACAGTGGCCAGTGGCAGG - Intronic
1118856908 14:69630265-69630287 TCTTTACAGTGGCCAGTGTTTGG - Intronic
1119788484 14:77329503-77329525 CTGTCACCGTGGCCAGTGGCAGG + Intronic
1125543808 15:40488245-40488267 CTGCTGCAGAGCCCAGTGGTGGG - Intergenic
1127804121 15:62502906-62502928 CTGTTAAAGAGCCCAGAGGTGGG + Intronic
1129976487 15:79826524-79826546 CTTTTCCAGCTGCCAGTGGTAGG - Intergenic
1130100817 15:80892539-80892561 CTGGTGCAGTGGCTAGAGGTCGG + Intronic
1130963735 15:88682084-88682106 CTGTCCCACTGGCCAGTGGTGGG + Intergenic
1133103879 16:3494682-3494704 CTCTCACACTGGCCAGTGGGTGG + Exonic
1135053163 16:19208688-19208710 CTGTCACAGTGTCTGGTGGTTGG + Intronic
1146253589 17:31374042-31374064 CTGTTACAGTGGCCAGTGGTAGG - Exonic
1146436003 17:32848574-32848596 ATGTTACAGAGGCCATTAGTGGG + Intronic
1146447028 17:32940387-32940409 ATGTTTCAGTGGGCAGCGGTTGG + Intronic
1148214331 17:45826166-45826188 CTGTTATCGTGGCCATCGGTCGG + Intronic
1148428832 17:47625262-47625284 TTGGAACAGTGGGCAGTGGTGGG + Intergenic
1149297974 17:55277872-55277894 CTGTTAAATTGGCTTGTGGTGGG + Intronic
1150227475 17:63531761-63531783 CTGTTAGACTGGAGAGTGGTCGG + Intronic
1151724713 17:75877403-75877425 CTGTTCCGGGGGCCAGTGGTGGG - Intronic
1158761860 18:60399669-60399691 CAATTAGAGTGGCCAGAGGTAGG + Intergenic
1160075766 18:75674988-75675010 CTGTAACATTGACCTGTGGTGGG + Intergenic
1160857453 19:1223934-1223956 CTGTTTCAGCGGGAAGTGGTGGG + Intronic
1164864762 19:31595614-31595636 CTGTTACAGCCCCCAGGGGTGGG - Intergenic
1167886179 19:52501702-52501724 CTGGTGCAGTGGGCAGTGGGGGG + Intronic
1168532366 19:57139889-57139911 CTGTTACAGGGGCCAGCGTCTGG + Intronic
925005663 2:441254-441276 CTGTCACAGTGGTCTGTAGTGGG - Intergenic
925202952 2:1983668-1983690 CAATGACAGTCGCCAGTGGTGGG - Intronic
926571891 2:14538051-14538073 GTGTCAGAGTGGCCAGTGATGGG - Intergenic
928185749 2:29109135-29109157 CCGTTTCAGTGGCAAGTGCTGGG + Intronic
929671464 2:43879154-43879176 CTTTCACAGTGGCCAGAGGATGG + Intergenic
931825079 2:65992002-65992024 GTGTTCCAGTGGCCAGTGAGAGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934949588 2:98567256-98567278 CTGTTAAAGTGGTCAGTGGAAGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936915944 2:117639123-117639145 CTGTTAGAGTGGCCACATGTTGG - Intergenic
939634098 2:144560153-144560175 CTGATACACTTGCCAGAGGTAGG - Intergenic
939833539 2:147101019-147101041 CTTTTTCAGAGGCCAGGGGTTGG + Intergenic
940207079 2:151214798-151214820 ATGTTACAGTTGCTAGTGGAAGG - Intergenic
942184065 2:173407585-173407607 CTGTCACTGTGGCCAAAGGTAGG + Intergenic
943555193 2:189394636-189394658 CTGTTACAGTAGCCTGAAGTGGG + Intergenic
944667523 2:201969787-201969809 CTGTTCCTATGGCCAGTCGTGGG - Intergenic
946278561 2:218649233-218649255 GTGGCACAGTGGGCAGTGGTGGG + Exonic
1170352743 20:15459938-15459960 CTGTTACTATGGCCAGTTTTGGG - Intronic
1176522388 21:7834154-7834176 CTGTTAGAGGGGCAAGTAGTGGG - Intergenic
1178656408 21:34464166-34464188 CTGTTAGAGGGGCAAGTAGTGGG - Intergenic
1181726169 22:24812468-24812490 GGCTTACAGTGGGCAGTGGTGGG + Intronic
1184433098 22:44453192-44453214 CCGTTACAGTGGAAAGGGGTAGG - Intergenic
952007104 3:28854658-28854680 TTGTTACAACTGCCAGTGGTTGG + Intergenic
960766454 3:121135764-121135786 CTGGTACTGTGGCCAGGGTTTGG + Intronic
961193692 3:124983759-124983781 CTGTCACAGTGGAGAGTGGTGGG - Intronic
961621188 3:128226390-128226412 CTGGTCCAGGGGCCAGCGGTTGG + Intronic
963199827 3:142574865-142574887 CTCTTACAGTTTCCAGTGCTTGG - Intronic
965849845 3:173010361-173010383 CTGTTACAAGGCCCACTGGTTGG + Intronic
966956989 3:184892075-184892097 CTGTTACACTGGCCATAGGGAGG + Intronic
969457516 4:7308531-7308553 CTGTTACACTGAGCACTGGTGGG + Intronic
977283030 4:95066240-95066262 CTGTCACAGGGGAGAGTGGTTGG + Intronic
981594313 4:146402148-146402170 CTCTTTCAGTGGACACTGGTAGG + Intronic
984383334 4:179023704-179023726 CTTTCACTGTGGCCAGTGTTTGG + Intergenic
987638860 5:20585050-20585072 GTGTTATAGTGGCTAGTGGGAGG + Intergenic
988036101 5:25829426-25829448 CTAGTACATTGGCCAGTGCTGGG + Intergenic
988609116 5:32709257-32709279 CTACCACTGTGGCCAGTGGTAGG + Intronic
989568708 5:42925471-42925493 CTGTGACAGTGGTCAGGGGAAGG - Intergenic
992081283 5:73235589-73235611 TTTTTACCTTGGCCAGTGGTTGG + Intergenic
995807008 5:116064252-116064274 CTGTTCCAGTGTTCAGTGATTGG - Intergenic
999449425 5:151667098-151667120 CTGTTTCAGTGGCCTGAGATGGG + Intronic
1001311702 5:170615643-170615665 CTGTTACCATGGCAAGTGGAGGG - Intronic
1001588092 5:172846739-172846761 CCCTTACAGTAGACAGTGGTGGG + Intronic
1001931109 5:175673641-175673663 GTGTTACAGTGTACAGTGTTGGG - Intronic
1009817953 6:68760808-68760830 CTATTATAGTGTCCTGTGGTGGG - Intronic
1016082168 6:139869502-139869524 CTGTTACATTAGCTAGGGGTAGG + Intergenic
1018067681 6:160134963-160134985 CTGTATCAGCGTCCAGTGGTAGG + Intronic
1018361490 6:163074928-163074950 GTGTTACAGTGGGCTGTGATTGG + Intronic
1022217386 7:28277935-28277957 CAGTTAAGGTGGGCAGTGGTGGG + Intergenic
1023541323 7:41269744-41269766 CTGTTACATTTGTCAGTGCTTGG + Intergenic
1024495288 7:50039092-50039114 CTGTGACAGTGACCAGATGTGGG + Intronic
1024560940 7:50644756-50644778 CTGCTCCACTGGCCAGTGGGTGG - Intronic
1030221223 7:107101284-107101306 GTGATGCAGTGACCAGTGGTTGG + Intronic
1030524142 7:110633426-110633448 CAGCTACAGTGGCCAGAAGTTGG - Intergenic
1031807313 7:126323915-126323937 ATGTTACGAAGGCCAGTGGTGGG + Intergenic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1034943063 7:155244491-155244513 CTGTTCCAGGGGCCCGTAGTGGG - Intergenic
1040567317 8:48579362-48579384 CAGCTACAGTGGCCAGTGGAGGG + Intergenic
1047295815 8:123569778-123569800 TTGCCACAGTTGCCAGTGGTAGG + Intergenic
1049187312 8:141263942-141263964 CTTTCAGAGTGGCCAGTGCTGGG - Intronic
1056329346 9:85509023-85509045 GGGTTACAGTGGCCAGAGGAAGG + Intergenic
1061718299 9:132535093-132535115 CTTTTACAGTGGACAGAGATAGG + Intronic
1062254052 9:135612818-135612840 CTGTGCCTGTGGCCAGGGGTGGG + Intergenic
1062270244 9:135704923-135704945 CTGTTACTGTGGCCACTCCTGGG - Intronic
1062327555 9:136019445-136019467 CTGCTACAGCGGCCAGTCCTGGG - Intronic
1062399084 9:136364624-136364646 CAGTTACAGGGGCCAGTGGGGGG - Intronic
1062690118 9:137837330-137837352 CTGTGACAGGGCCCAGTTGTGGG - Intronic
1190813426 X:53907003-53907025 CTGGTCCAGTGCCCAGGGGTTGG + Intergenic
1193697360 X:84724916-84724938 CTGCTGCAGCTGCCAGTGGTAGG + Intergenic
1195284098 X:103366668-103366690 CTGTGACAGTGGCCAGATGCAGG - Intergenic
1195993286 X:110704712-110704734 TTGTTTCAGTGGGCAGTAGTGGG + Intronic
1197419377 X:126219484-126219506 CTATTACAGTGTACAGTTGTAGG + Intergenic
1198684067 X:139209236-139209258 CTGCTACAGTGGCCAAGAGTTGG - Intronic