ID: 1146255496

View in Genome Browser
Species Human (GRCh38)
Location 17:31389778-31389800
Sequence CGACCTACCCTGCAAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146255496_1146255502 29 Left 1146255496 17:31389778-31389800 CCTCCATTTTGCAGGGTAGGTCG No data
Right 1146255502 17:31389830-31389852 TCATCTTCAGTTGCCCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146255496 Original CRISPR CGACCTACCCTGCAAAATGG AGG (reversed) Intergenic
No off target data available for this crispr