ID: 1146260082

View in Genome Browser
Species Human (GRCh38)
Location 17:31415263-31415285
Sequence TGTCCACGTAGAGCGCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146260082_1146260090 -3 Left 1146260082 17:31415263-31415285 CCAGGGGGCGCTCTACGTGGACA 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1146260090 17:31415283-31415305 ACAAAGAGGAGGGGAGGGGCAGG 0: 1
1: 2
2: 28
3: 259
4: 1860
1146260082_1146260091 4 Left 1146260082 17:31415263-31415285 CCAGGGGGCGCTCTACGTGGACA 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1146260091 17:31415290-31415312 GGAGGGGAGGGGCAGGATAGTGG 0: 1
1: 0
2: 30
3: 346
4: 2271
1146260082_1146260087 -9 Left 1146260082 17:31415263-31415285 CCAGGGGGCGCTCTACGTGGACA 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1146260087 17:31415277-31415299 ACGTGGACAAAGAGGAGGGGAGG 0: 1
1: 0
2: 1
3: 36
4: 354
1146260082_1146260088 -8 Left 1146260082 17:31415263-31415285 CCAGGGGGCGCTCTACGTGGACA 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1146260088 17:31415278-31415300 CGTGGACAAAGAGGAGGGGAGGG 0: 1
1: 0
2: 1
3: 48
4: 524
1146260082_1146260089 -7 Left 1146260082 17:31415263-31415285 CCAGGGGGCGCTCTACGTGGACA 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1146260089 17:31415279-31415301 GTGGACAAAGAGGAGGGGAGGGG 0: 1
1: 0
2: 8
3: 146
4: 1075

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146260082 Original CRISPR TGTCCACGTAGAGCGCCCCC TGG (reversed) Intronic
901127517 1:6939993-6940015 TGGCCACGTAGAGCTGTCCCTGG - Intronic
903767405 1:25743662-25743684 TGGCCTCATAGAGCGTCCCCAGG + Intronic
920548676 1:206839879-206839901 TGTCCACGTAGAACGCCAGGAGG - Exonic
924860420 1:247915065-247915087 TGTCCACCTAGAGTGCCAACTGG + Intergenic
1076912994 10:133401707-133401729 TGTCCCCGCTGAGCACCCCCGGG + Intronic
1078508546 11:11968964-11968986 TGCCCACAGAGAGCGCCCTCAGG + Intronic
1101968488 12:109296496-109296518 TGGCCAACTAGAGCGCTCCCTGG - Intronic
1121648121 14:95535024-95535046 TGGCCACCCAGAGCGCTCCCCGG - Exonic
1131424173 15:92331976-92331998 TGTCCAGCTAGAGCTCCCCATGG - Intergenic
1133524628 16:6592733-6592755 TGTGCACAGAGAGCTCCCCCTGG + Intronic
1134211343 16:12279981-12280003 TCTCCACGGAGAGCGCTGCCTGG - Intronic
1137702858 16:50509752-50509774 TCTGCATATAGAGCGCCCCCTGG + Intergenic
1142032706 16:87846480-87846502 TGTCCACGTACAGCCACACCGGG - Intronic
1142668846 17:1478053-1478075 GGCCCACGGAGAGTGCCCCCAGG + Intronic
1146260082 17:31415263-31415285 TGTCCACGTAGAGCGCCCCCTGG - Intronic
1146935154 17:36808561-36808583 TGGCCACGTTGAGCGCGCCGAGG + Intergenic
1149589765 17:57819871-57819893 TGTCCAAGTTGAGCGGCCCTGGG + Intergenic
1161357117 19:3825330-3825352 TGGCCACAGAGAGCCCCCCCGGG - Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167793123 19:51692768-51692790 TGTCCACCTGCCGCGCCCCCCGG + Intergenic
927159239 2:20242423-20242445 CGTCCGCCGAGAGCGCCCCCTGG - Intergenic
1179731477 21:43370253-43370275 TGTCCACGCCGCACGCCCCCCGG + Intergenic
1182080733 22:27526955-27526977 TGTCCACGGAAAACACCCCCGGG + Intergenic
961743082 3:129046192-129046214 CGTCCACGTCCAGCGCGCCCTGG - Intergenic
967896152 3:194397418-194397440 TCTCCCCGAAGAGCACCCCCGGG + Exonic
979770258 4:124515662-124515684 TGTCTAAGTAAAGGGCCCCCGGG - Intergenic
1002485296 5:179530813-179530835 TGTCCCCGGAGAGGGCGCCCTGG - Intergenic
1002925607 6:1604431-1604453 TGTCCCCGCACAGCGTCCCCTGG - Intergenic
1018613403 6:165663289-165663311 CGCCCACGTAGCGCGCCCCGCGG + Intronic
1023981723 7:45074365-45074387 TGTCCCCGTAGAGCTGCCGCAGG - Exonic
1027592549 7:80134724-80134746 TGCCCTCGGACAGCGCCCCCCGG - Intronic
1032406284 7:131658231-131658253 TTTCCACGTAGAGAGCTCACGGG - Intergenic
1051596151 9:18826167-18826189 TGTCCCTGTAGAGCAGCCCCAGG + Intronic
1061208905 9:129179428-129179450 GGTCCAGATAGAGCGCCCCCAGG - Intergenic
1062117613 9:134817856-134817878 TGACCGCGTAGACCTCCCCCAGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200949398 Y:8879489-8879511 TGTCCACCTAGAGTGAACCCTGG - Intergenic