ID: 1146263127

View in Genome Browser
Species Human (GRCh38)
Location 17:31434383-31434405
Sequence CAGGGAAAGTGGCAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 438}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146263120_1146263127 12 Left 1146263120 17:31434348-31434370 CCATCTGTGGCACGGAGGAGAGA 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG 0: 1
1: 0
2: 1
3: 43
4: 438
1146263114_1146263127 29 Left 1146263114 17:31434331-31434353 CCCAGCAACTTTATTTCCCATCT 0: 1
1: 0
2: 3
3: 19
4: 345
Right 1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG 0: 1
1: 0
2: 1
3: 43
4: 438
1146263115_1146263127 28 Left 1146263115 17:31434332-31434354 CCAGCAACTTTATTTCCCATCTG 0: 1
1: 0
2: 1
3: 27
4: 243
Right 1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG 0: 1
1: 0
2: 1
3: 43
4: 438
1146263119_1146263127 13 Left 1146263119 17:31434347-31434369 CCCATCTGTGGCACGGAGGAGAG 0: 1
1: 0
2: 2
3: 9
4: 120
Right 1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG 0: 1
1: 0
2: 1
3: 43
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146263127 Original CRISPR CAGGGAAAGTGGCAAGTGGA GGG Intronic
900472517 1:2861807-2861829 CAGGGAGAGTGGTACGTGGCAGG - Intergenic
900958956 1:5907208-5907230 CTGGGAAATTGACAACTGGAAGG + Exonic
901872887 1:12148478-12148500 CAGGGACAGTTGCAAGAGGCAGG + Intergenic
901922623 1:12547853-12547875 CAGGGCAAATGCCAGGTGGATGG - Intergenic
901927056 1:12573004-12573026 GAGGGAATGTGGCACCTGGATGG - Intronic
902938839 1:19785100-19785122 CAGGGAGAATGGCAGGTGCAAGG - Intronic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
904900909 1:33856355-33856377 CAGAGAAAGAGGGAAGTTGATGG - Intronic
905429130 1:37908908-37908930 AAGGGAGAATGGCGAGTGGAAGG - Intronic
907308063 1:53524608-53524630 AAGGGCAGGTGGGAAGTGGACGG + Intronic
908445524 1:64196295-64196317 AAGGTCAAGGGGCAAGTGGAGGG - Intergenic
908810925 1:67981709-67981731 TAGGGACAGTGGCAATTAGATGG - Intergenic
909090052 1:71214560-71214582 GGGGAAAAGTGGGAAGTGGAGGG - Intergenic
909844501 1:80374902-80374924 CAAGGAAAGTTGCGGGTGGAGGG - Intergenic
910120342 1:83781675-83781697 CAGGCAAAGAGGGAAGGGGAAGG + Intergenic
910265978 1:85338062-85338084 AAGGAATAGTGGCAAGAGGAAGG - Intronic
910569981 1:88689059-88689081 CAGTGACACTGGAAAGTGGAAGG + Intronic
910645226 1:89507210-89507232 GAGGGAGAGTGGAGAGTGGAGGG - Intergenic
910704237 1:90109869-90109891 AAGAGAAAAGGGCAAGTGGAGGG - Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912711450 1:111952821-111952843 GAGGGAAAGAGACAAGGGGATGG + Intronic
912838760 1:113020305-113020327 AGGAGAAAGTGGGAAGTGGATGG + Intergenic
914196779 1:145451871-145451893 CAGGCAAAGTGGGAGGAGGAGGG + Intergenic
914948847 1:152092038-152092060 TATGGAAAATGGAAAGTGGATGG + Intergenic
915109254 1:153552705-153552727 GAGGGCAGGTGGCAAGAGGAAGG - Intergenic
915172140 1:153985646-153985668 CAGGGAACCTGGGAAGTAGATGG + Intronic
915723828 1:158003471-158003493 CAGGGAGAGTGGGGAGTGGTGGG - Intronic
917476363 1:175372660-175372682 CAGGGAAAGTGGTAGGGAGAAGG + Intronic
917685117 1:177407956-177407978 CTGAGACAGTGGCAAGTGAAAGG - Intergenic
917865568 1:179191002-179191024 AAGGGGAAGTGGGAAGTGGCTGG - Intronic
917954897 1:180085097-180085119 AAGGGAAAGGGGAAAGGGGAAGG - Intronic
918430284 1:184452539-184452561 GAGGCAAAGTGGCAAGAAGAGGG + Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
921079239 1:211725491-211725513 GAGGTAAAGTAGCAACTGGAAGG - Intergenic
922740825 1:228013444-228013466 CAGGGAAACTGGCAAGTGCGTGG + Intronic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923546077 1:234924159-234924181 TAGGGAAAGAGGCAAGAGAAGGG + Intergenic
923659891 1:235948943-235948965 AAGGGAAAGTGGTAAATGAAAGG - Intergenic
923916081 1:238506368-238506390 AAGGGAAACTGGCAAATGCATGG + Intergenic
1063674868 10:8131914-8131936 CAGTGAAAGTGGCAAGCAGGGGG - Intergenic
1063840421 10:10065462-10065484 CGAGGACAGTGCCAAGTGGATGG + Intergenic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1064265744 10:13823888-13823910 CTGGAAAAGTAGCAAGTGGCTGG - Intronic
1064402250 10:15031177-15031199 CATGGAAAGTGGAAAGTTCAGGG + Intergenic
1065876265 10:30000088-30000110 GAGGGACAGTGACAAGAGGAGGG - Intergenic
1065887578 10:30092300-30092322 CAGGGAAGGTGATAAGTGGCAGG + Intronic
1066290606 10:34011175-34011197 CAGGGAGAGTGGGAAGGGCAAGG + Intergenic
1066675701 10:37884788-37884810 CAGGGAAAGCATCAAGTGCAGGG + Intergenic
1067835293 10:49634560-49634582 CAGAGAGAGTGGTACGTGGAGGG - Intronic
1069385921 10:67883641-67883663 CAGGGAGAGAGGAAAGTGGAAGG + Intergenic
1070274181 10:74988941-74988963 CAAGGACAGTGGCAGGTGCAGGG + Intronic
1070437336 10:76406126-76406148 CAGGGGAAGTGCTGAGTGGATGG + Intronic
1070983073 10:80665834-80665856 CAGGGTTAGTGGGAAGGGGACGG + Intergenic
1071388817 10:85149390-85149412 ATGGGAAATTGGCAAGGGGATGG - Intergenic
1071749690 10:88460741-88460763 GAGGGAAAGTGGGAAATAGAAGG - Intronic
1072543501 10:96416376-96416398 CAAGGAAAGTGCCCAGTGCAGGG - Intronic
1073203853 10:101758155-101758177 CAGCGAAAGTAGCAACTGAAAGG - Intergenic
1074082979 10:110182446-110182468 GAGAGAAGGTGGCAAGTGCAGGG + Intergenic
1074844881 10:117388981-117389003 CGGGGAAAGGGGAAAGTGAAGGG - Intergenic
1075122666 10:119675794-119675816 CAGGGAAGGGGGGAAGGGGAAGG - Intronic
1075244622 10:120810357-120810379 GAGGGAAACTGGCAGGAGGAGGG - Intergenic
1075654597 10:124152763-124152785 CAGGGAGAGTGGGCAGTGCAGGG - Intergenic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1076134470 10:128036074-128036096 CAGGGATGTTGGGAAGTGGACGG + Intronic
1076209316 10:128627749-128627771 CAGGGAATGTGGCAAATGGCAGG + Intergenic
1076235151 10:128858298-128858320 CAGGGAAAGAGGCGAGAGCAAGG + Intergenic
1076425509 10:130364648-130364670 CAGAGAAAGTGGCAACGTGAAGG + Intergenic
1076545232 10:131240752-131240774 CAGGAAAAGTGAGAAGGGGAAGG + Intronic
1076795100 10:132794524-132794546 CAGGGACAGTGGCAATACGAGGG + Intergenic
1077227603 11:1445184-1445206 CAGGGAGAGTGGCAGGATGAAGG + Intronic
1077632088 11:3817632-3817654 GAGGGAAAGGGACAAGGGGATGG + Intronic
1078275625 11:9842710-9842732 CAGGGAAAATGACAATTGGGCGG - Exonic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1079317976 11:19425962-19425984 CAGAGAAAGAGGGAAGTAGATGG + Intronic
1079827232 11:25212274-25212296 AAGGGAAAATGGCAAGTAGGAGG - Intergenic
1080073673 11:28120714-28120736 CAGGGAAAAGGGCAAGTATAAGG - Intronic
1080709534 11:34733824-34733846 CAGGCCAAGTTGCCAGTGGATGG + Intergenic
1081063545 11:38510151-38510173 GAGGGATAGTGACAAGTTGAAGG - Intergenic
1081700518 11:45149661-45149683 CAGGGAAAGTGCACTGTGGAGGG - Intronic
1081935305 11:46899816-46899838 CAGGCAAGGTGGCCAGTGGGTGG - Intronic
1083106478 11:60363210-60363232 CAGGGAAAGATGGAAGAGGAAGG - Intronic
1083143077 11:60737730-60737752 CAGAGAAAGTGGAGAGGGGAAGG - Intronic
1084689709 11:70718014-70718036 CTGGTACAGTGGGAAGTGGAAGG - Intronic
1084708558 11:70830038-70830060 CAGGGAAGGGGGCAAGTGGTGGG - Intronic
1085200290 11:74697733-74697755 CAGGGAGGGAGGGAAGTGGAAGG + Intronic
1085295396 11:75428779-75428801 CAGGCAAAGTTGGAAGTGGCAGG - Intronic
1085389157 11:76173522-76173544 CAGGGGGAGTGGCACCTGGACGG + Intergenic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1089485409 11:118841724-118841746 AAGTGAAAGTGGCAAGTGTATGG - Intergenic
1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089892333 11:121894048-121894070 CAGGGGATGTCGGAAGTGGATGG + Intergenic
1090873709 11:130770291-130770313 CAGGGAAAGTGGAATGTGAGTGG - Intergenic
1090936504 11:131347658-131347680 CAGGCAAAGTAGCTATTGGAAGG + Intergenic
1090985316 11:131761137-131761159 CCGTGAAAGTGGCAAGAGGCAGG + Intronic
1091046538 11:132330591-132330613 GAAGGGAAGTGGCAAGGGGAGGG + Intronic
1092165205 12:6338155-6338177 CAGGGAAATGGTCATGTGGAAGG - Intronic
1093643463 12:21554983-21555005 GAGGGAAAGTGGGAAAAGGAGGG - Intronic
1095175971 12:39092535-39092557 CAGGGCATGTGGCAAGTTTAAGG - Intergenic
1095241222 12:39861065-39861087 TAAGGAACGTGGCAAGTGCAAGG - Intronic
1096069459 12:48766917-48766939 CAGGGAAAGGGGTAAAAGGAAGG + Exonic
1096706953 12:53428304-53428326 GAGGGCAAGTGGGAATTGGAGGG - Intronic
1097934402 12:65228977-65228999 GTGGCAAAGTGGCAGGTGGAGGG - Intronic
1098388934 12:69948886-69948908 CAGGGAAAGTTCCCAGGGGAAGG - Intronic
1098855952 12:75653434-75653456 CAGGGAAAGAGTGAAGTTGAAGG - Intergenic
1099357128 12:81651527-81651549 GAGGGAAAGAGTCAAGTAGAGGG - Intronic
1099438934 12:82677370-82677392 CATTAAAAGTGGCAACTGGAAGG - Intergenic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1099698896 12:86059771-86059793 CAGAGAAAGGGGCAAGTGAAAGG - Intronic
1099915973 12:88893712-88893734 CAGGGATGGTGGCAAGGAGATGG + Intergenic
1100164079 12:91896189-91896211 GAGGGAAAGCCGGAAGTGGAAGG + Intergenic
1100752428 12:97713553-97713575 CAGGGAAAATGGCATGCAGAAGG - Intergenic
1101062796 12:100989236-100989258 AAGAGAAAGTGGGAACTGGAAGG + Intronic
1101241774 12:102846327-102846349 CAGGCAATGTGGCTAGTGGCTGG + Intronic
1102363671 12:112312091-112312113 CATGGAAAGTGGGAAATGAAAGG + Intronic
1103018332 12:117513518-117513540 GAGGGAAAGGGACAAGTGGCAGG + Intronic
1103478903 12:121238255-121238277 CAGAGGAAATGGGAAGTGGATGG + Exonic
1103693823 12:122798008-122798030 CAGGGAAAGTGCCAAATTGTTGG + Intronic
1103919360 12:124391368-124391390 CGGGGAAAATGGCAGGTGGGGGG - Intronic
1104071753 12:125351959-125351981 GAGGGAGACTGGCAGGTGGAAGG - Intronic
1104108349 12:125684119-125684141 CAGGGAAAGTGAAAAGGGGAAGG - Intergenic
1104209963 12:126679224-126679246 CTGGGAAAGAGGCACATGGATGG - Intergenic
1104327381 12:127812265-127812287 CGTGGAAAGTGGCAAGTGAAGGG - Intergenic
1104509718 12:129366320-129366342 CAAGGACAGTGCCAAGGGGATGG - Intronic
1106413448 13:29526607-29526629 CAGGGCAAGTGGAAAGTGCAGGG + Intronic
1106597879 13:31161998-31162020 AAGCGGAAGTGGCACGTGGAGGG - Intronic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107246368 13:38301148-38301170 GAGGGTAAGTGGCAAATGAAAGG - Intergenic
1107354635 13:39553854-39553876 CAGGGAAATTGGCAGGTGGCTGG - Intronic
1107872985 13:44764149-44764171 AAGGGGAAGTGGCCAGTGGCCGG - Intergenic
1108511256 13:51157900-51157922 CAAGGAAAGAGGAAAGAGGAAGG + Intergenic
1112763237 13:102713793-102713815 CAGTAAAAGAGGCAAGAGGAGGG + Intergenic
1113512813 13:110869559-110869581 CAGGGATGGTGACAAGCGGAAGG - Intergenic
1113858045 13:113460213-113460235 CAGAGAGTGTGGCAGGTGGAGGG - Intronic
1114082332 14:19211720-19211742 CAAGGACAGTGCCAAGAGGATGG - Intergenic
1115466965 14:33725963-33725985 AAGAGAAAGTGGGAGGTGGAGGG - Intronic
1115470078 14:33759429-33759451 CAGGCAAAATGGGAAGTGGCAGG + Intronic
1118625617 14:67656378-67656400 CAGGGAAAGGGGCAAGTATGGGG - Intronic
1120396372 14:83971858-83971880 GAGGGAAATGGACAAGTGGAGGG + Intergenic
1121504468 14:94466033-94466055 CAGGGAAAGAGGACAGTGGCAGG - Intronic
1121615770 14:95312459-95312481 CAGGGCACGTGACAAGTAGAAGG - Intronic
1121928710 14:97952522-97952544 GAGGGAAAGGGGAAAGGGGAGGG - Intronic
1122012142 14:98759110-98759132 CAGGGAAGGTGGAAAGTCAAAGG - Intergenic
1122058837 14:99123282-99123304 CAGGGGAAGAGGGAAGGGGAAGG - Intergenic
1122114250 14:99520034-99520056 CAGGGCAGGTGCCCAGTGGAGGG - Intronic
1122277665 14:100603575-100603597 CAGGGAGATTGGCCAGGGGAGGG - Intergenic
1122342888 14:101039836-101039858 CAGGGTAAGTGGAAAGTCGGTGG + Intergenic
1122575104 14:102737145-102737167 CAGGGTCACTGGTAAGTGGAGGG + Intergenic
1122907514 14:104808567-104808589 GAGGGAAAGTGGGAGGGGGAGGG - Intergenic
1125402880 15:39322649-39322671 CAAGCAAAGGGGCATGTGGAGGG + Intergenic
1125665821 15:41429314-41429336 CAGGGACAGAGAGAAGTGGAAGG - Intronic
1127507738 15:59611239-59611261 GAGGGAAAGAGGAAAGGGGAAGG - Intronic
1127855455 15:62950207-62950229 CAGGGGAGGTGGGAACTGGAAGG - Intergenic
1128619977 15:69140589-69140611 CAGGGCAGGAGGCAAGTGGGAGG - Intergenic
1128737462 15:70061304-70061326 CAGGGAAAGGAGCAAGGGCAGGG + Intronic
1128994908 15:72288996-72289018 CAGGGAGTGTGGGAGGTGGACGG + Intronic
1129373124 15:75110274-75110296 CAGGGCAGGTGGGAAGTGGAAGG - Intronic
1129629074 15:77236883-77236905 AAGGAAAAGTGCCAAGTGAAAGG - Intronic
1129667657 15:77588455-77588477 CAGGTAATGTAGTAAGTGGATGG - Intergenic
1130199680 15:81813431-81813453 CAGGGAAGGTGGGAATGGGAGGG - Intergenic
1131106673 15:89739449-89739471 TAGGGAGAGTGGAAAGAGGAAGG - Intronic
1131117857 15:89805540-89805562 CAGGGAAAGGGGTACATGGAAGG + Intronic
1131789558 15:95949266-95949288 CAGAGAAGGAGGCAAGAGGAGGG + Intergenic
1132768271 16:1546154-1546176 CAGGGCAAGTTGCCAATGGAAGG + Intronic
1134832939 16:17338106-17338128 CAGGGAAAGTGGGAAAGGAAAGG - Intronic
1134900359 16:17932580-17932602 AAGAGAAAGTGGTAAGTGGCGGG - Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135544352 16:23355728-23355750 CAGGGAAAGTGGGATAAGGAAGG + Intronic
1136102361 16:28005428-28005450 CAGGGAGAATGCCATGTGGATGG - Intronic
1136483966 16:30559298-30559320 CAGGGAGACTGGCAATTGGGAGG - Intergenic
1136541262 16:30928647-30928669 AAGGGAAGGTGGGAAGGGGAGGG - Intronic
1136586514 16:31189709-31189731 CAGGGAAACTGGCAAGCTGAAGG + Exonic
1139208972 16:65057645-65057667 GAGGGAAAGTGGAAAAAGGAAGG - Intronic
1139760780 16:69183297-69183319 CAGGGACAGGGGCAAGCAGAGGG - Intronic
1139948426 16:70657275-70657297 CAGGAAAAGAGGCCTGTGGAAGG + Intronic
1141040390 16:80667970-80667992 CAGGGAGAGACACAAGTGGAAGG + Intronic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141244718 16:82295058-82295080 CAGGCAAAGTGGCAAGTCCAAGG - Intergenic
1141948916 16:87328284-87328306 CAGGGCATGTGGCTAGAGGAAGG + Exonic
1142249343 16:88983953-88983975 CAGGGAAAGTGGCCTCCGGACGG - Intergenic
1142473111 17:174076-174098 CAGGGAAATTGGCTAATGAAAGG + Intronic
1142994048 17:3750635-3750657 CAGAGGAAGTGGCATTTGGATGG + Intronic
1143632291 17:8146202-8146224 CAGGGAAAAGGGGAAGGGGATGG + Intronic
1143890684 17:10099901-10099923 CAGGGACAGTGGACAGTGGAAGG + Intronic
1144553437 17:16261168-16261190 CTGGGAATGTGGCAAGCAGAGGG - Intronic
1145961850 17:28891318-28891340 CAGGGAATAAGGCAAGTGGAGGG + Intronic
1146103273 17:30006797-30006819 CAGGCAAAGTGGCATGTGCCAGG - Intronic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1148111388 17:45146435-45146457 CAGGCAAAGTGGCACGAAGAGGG - Intergenic
1149291812 17:55225061-55225083 CTGGGAAGGTGGTATGTGGATGG - Intergenic
1149993224 17:61394172-61394194 CAGGGAAAGTGGTGGGTGTAGGG + Intergenic
1150290654 17:63979636-63979658 CAGGGGTGGAGGCAAGTGGAAGG - Intergenic
1152337825 17:79708082-79708104 CAGGGCAGGTGGCAAGTAGGGGG - Intergenic
1152928375 17:83098228-83098250 GAGGGAAAAGGGCAGGTGGAGGG - Intergenic
1153692311 18:7606052-7606074 CAGGCAGAGTGGGAAGTGGGAGG + Intronic
1155757639 18:29521241-29521263 CAGGGAAATTGGCAGGTTGTTGG + Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1155983268 18:32203206-32203228 TAGACAAAGTGGAAAGTGGATGG + Intronic
1157289289 18:46398588-46398610 CAGGGAGAGTGGGAAGAGAAGGG + Intronic
1157910228 18:51610527-51610549 AAGGAAAAGTGCCAAGTGAAGGG + Intergenic
1158591424 18:58782117-58782139 GAGGGATGGTGGCAAGAGGAGGG - Intergenic
1159348027 18:67232276-67232298 CAGGGAGCGTGGTAAGTTGAAGG + Intergenic
1159482476 18:69007887-69007909 CAAGGAAAGAGGAAAGAGGAAGG - Intronic
1159643550 18:70890959-70890981 CTGGGAAGGTGGGAAGTGAAAGG + Intergenic
1160178645 18:76615895-76615917 CAGGGAAGGTGGAAGGGGGATGG + Intergenic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160986248 19:1840263-1840285 GAAGGAAAGTGGGAAGGGGAAGG + Intronic
1162590444 19:11587891-11587913 CAGGCCTAGTGGCAAGTGGGGGG - Intronic
1162840851 19:13355476-13355498 AAGGGAAGGTGGCAAGTGAAGGG + Intronic
1163431266 19:17269081-17269103 CAGAGAAAGTGGTAAGTAGAGGG + Exonic
1163703406 19:18798613-18798635 CAGAGAAAGTGGAGAGTGCAGGG + Intergenic
1164589100 19:29496336-29496358 CTGGGATAGTGGCAAGTGAGAGG + Intergenic
1165845117 19:38813071-38813093 CAGGGAAGCTGGCAAGGGAAGGG - Exonic
1166214028 19:41324130-41324152 CAGGGAAAGTGAGAGCTGGATGG + Exonic
1166837727 19:45677543-45677565 CAGGGCAATCGGCAAGGGGAGGG + Intronic
1167548525 19:50143772-50143794 CAGGCAAAGTGGGCAATGGATGG - Intergenic
925183472 2:1831672-1831694 CTGGGAAAGTGGCGAGAGGCCGG - Intronic
926352192 2:12006108-12006130 CAGGGAAAGTGCCAAATGGCAGG + Intergenic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
927620183 2:24647777-24647799 ATGTGAAAGTGGCAACTGGAAGG + Intronic
927724272 2:25409088-25409110 CTGGAAAAGTGGCAGGTGGGAGG + Intronic
927894738 2:26774445-26774467 GAGGGAAAGAGAGAAGTGGATGG - Intronic
929453405 2:42050765-42050787 CAGGAAAAGTGAAAAGTGGGGGG + Intronic
930034486 2:47076881-47076903 CCTGGAAAGTGGCACGTGGGTGG - Intronic
931543873 2:63359078-63359100 GAGGGAAAGTGGAAAGAGGAAGG - Intronic
932488466 2:72103298-72103320 GAGGGAAAGAGGCTAGGGGATGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
934818476 2:97351301-97351323 CAGGGAGGGTGGCAAGAGGTTGG + Intergenic
935558712 2:104538887-104538909 CAAGGAAAGAGGCAAGTTCAAGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937040657 2:118818124-118818146 CAGGAAATGAGGCATGTGGAGGG + Intergenic
937094072 2:119224349-119224371 CAGGGACAGGGGCAGGTGCAGGG + Intronic
937131488 2:119517500-119517522 CAGTGAATGTGGCAAATCGAAGG + Intronic
937318153 2:120945073-120945095 GAGGGAAAGAGGGAAGAGGAAGG + Intronic
937643864 2:124244225-124244247 CAGGGAAAGTGACAAGGGTGAGG - Intronic
937993628 2:127677590-127677612 AAGGGGAGGTGGCAGGTGGAGGG + Intronic
938494254 2:131784883-131784905 CAAGGACAGTGCCAAGAGGATGG + Intergenic
940083716 2:149834230-149834252 CAGGGTAGGGGGCTAGTGGAGGG - Intergenic
940253582 2:151706148-151706170 GTGGGAAAGTGGCAAGTGAGAGG - Intronic
941320583 2:164049425-164049447 GAGGTAAAATGGCCAGTGGATGG + Intergenic
941416318 2:165225700-165225722 CAGGGAAAATAGCTAATGGATGG + Intergenic
941486265 2:166086256-166086278 GAGGGAAAGTGTCAGGTGGTTGG - Intronic
942547282 2:177078419-177078441 AAGGGAAAATGGCAAAGGGAAGG + Intergenic
942559574 2:177206404-177206426 CAGGGAAAGTGGCCACTCGTAGG + Intergenic
942671168 2:178377658-178377680 CAGGGTAGATGGCAAGTGCAGGG - Intronic
942738372 2:179142553-179142575 TAGGCACAGTGGGAAGTGGATGG - Intronic
944458744 2:199921985-199922007 AAGGGAAATGGGCAACTGGAGGG - Intronic
945471147 2:210229006-210229028 AAGGGAAACTGGAAAGGGGATGG + Intergenic
947455428 2:230249758-230249780 CAAGGAAAGGGGCAGGTCGAGGG + Intronic
947616104 2:231557759-231557781 CAGGGAAAGGGGGAAACGGAAGG + Intergenic
948498407 2:238370805-238370827 AAGAGAAAGGGGGAAGTGGAAGG + Intronic
948695710 2:239732160-239732182 GAAGGAAGGTGGCAGGTGGAGGG - Intergenic
949044248 2:241863674-241863696 GATGGAAAGTGGCGAGGGGAGGG + Intergenic
1168817903 20:753377-753399 AAGGGAAAATGGGAAGTAGAGGG + Intergenic
1168953573 20:1818981-1819003 CAGGAAGGGTGGCAAGGGGAAGG - Intergenic
1169159161 20:3361477-3361499 CAGGGAAAGTGGGAGGTGGGAGG + Intronic
1169755161 20:9035697-9035719 CAGGGAAAGGGGTAAATTGAAGG + Intergenic
1169802403 20:9523650-9523672 CAGGGTAAGTGGCTTGTGGCTGG - Intronic
1170134182 20:13055010-13055032 CTAGGAAAGAGGCAGGTGGAAGG + Intronic
1171179252 20:23080523-23080545 CAGGGAAGATGGCATGTGGCTGG + Exonic
1171898091 20:30829471-30829493 CAGAGACAGTGGAATGTGGAGGG + Intergenic
1172217502 20:33246578-33246600 CAGTGAAAGTGGCAAAGGAAAGG + Intergenic
1172646750 20:36475009-36475031 CAGGGAAAGTGACTGCTGGATGG + Intronic
1172997681 20:39083241-39083263 CAGGCAAAGAGGCAAGGGGCTGG + Intergenic
1173455674 20:43199427-43199449 CAGGGATATTGGCAAGGGGAAGG + Intergenic
1173569411 20:44066895-44066917 CAGGGAGAGTGGGAACAGGATGG + Intronic
1174449095 20:50608981-50609003 CAGGGAGAGTGGAAGGCGGAGGG - Intronic
1175192029 20:57217698-57217720 CAGGGAATGTGGCCACTGAAGGG + Intronic
1175466308 20:59192868-59192890 CAGGAGAAGTGGCAGGTGTACGG + Exonic
1175493578 20:59396035-59396057 CATGGAATCTGGGAAGTGGAGGG - Intergenic
1175531232 20:59675119-59675141 GAGGGAGAGGGGTAAGTGGAGGG - Intronic
1175531252 20:59675175-59675197 GAGGGAGAGGGGTAAGTGGAGGG - Intronic
1176201926 20:63864992-63865014 CTGGGAAGGTGGGAAGTGGGAGG - Intergenic
1176613662 21:9009482-9009504 CAAGGACAGTGCCAAGAGGATGG - Intergenic
1176711521 21:10154392-10154414 CAAGGACAGTGCCAAGAGGATGG + Intergenic
1178367483 21:31999445-31999467 TGGGGGAAGTGGGAAGTGGAAGG - Exonic
1178407287 21:32335146-32335168 CAGGGAAACAGGCAATGGGAAGG - Intronic
1178564303 21:33668964-33668986 AAGGGGATGTGGCAAGTGGATGG + Intronic
1178581759 21:33844319-33844341 CAGGGAAAATGGAATGTGCAGGG + Intronic
1178681851 21:34679250-34679272 AAGGAAAAGTGCCAAGTGAAAGG + Intronic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1179510033 21:41866510-41866532 CAGGCTTAGTGTCAAGTGGAGGG - Intronic
1180147113 21:45927887-45927909 CAGGGAATGGGGCACGGGGAGGG - Intronic
1180498444 22:15910950-15910972 CAAGGACAGTGCCAAGAGGATGG + Intergenic
1180861534 22:19085481-19085503 TGGGAAATGTGGCAAGTGGAAGG - Intronic
1181675675 22:24450101-24450123 CAGGGAATGGGGTAAGAGGATGG - Intergenic
1181753220 22:25004548-25004570 CAGGGAAATGGGCAGATGGAGGG - Intronic
1182295949 22:29311362-29311384 CAGGGTATGTGGCTGGTGGACGG - Intronic
1182915099 22:34022073-34022095 ATGGGAAAGGGGCAAGTGAAAGG + Intergenic
1183175039 22:36217323-36217345 CATGGAGGGTGGCAAGAGGAAGG - Intergenic
1183328418 22:37206699-37206721 CAGGGAGGGGGGCAAGGGGAAGG - Exonic
1184015224 22:41780945-41780967 GAGGGGATGTGGCAAGTGCAGGG + Intronic
1184949929 22:47834051-47834073 TTGGAAAAGTGGCAAGAGGAAGG + Intergenic
1184955923 22:47885826-47885848 CCGGGACAATGGGAAGTGGATGG + Intergenic
949471582 3:4402108-4402130 CAGGGCTAAGGGCAAGTGGAGGG + Intronic
949585772 3:5435365-5435387 CAGGGAAAGTGAAAAGTAAAGGG - Intergenic
950132443 3:10556472-10556494 CAGGGCGAGTGGCAAGTGACAGG + Intronic
952711347 3:36435241-36435263 CAGAGACAGTGGGAGGTGGAGGG - Intronic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953697829 3:45173449-45173471 CTGGGAAAGAGGCACCTGGATGG - Intergenic
954067684 3:48119802-48119824 TAGGGAAAGTGGCAAAAGCAGGG - Intergenic
954609426 3:51936536-51936558 CAGGGAGCGTGGAGAGTGGACGG - Exonic
954757514 3:52849559-52849581 CAGGGAAGGTGGCAGGAGGCAGG - Intronic
955102382 3:55863009-55863031 ATGGGAAAATGGGAAGTGGAGGG - Intronic
955495759 3:59530602-59530624 AAGGAGAAGTGGCAAGTGAAGGG + Intergenic
957216366 3:77324994-77325016 CAGAGTAAGTGCCAAGTGGAAGG + Intronic
958867818 3:99521769-99521791 CAGGGAAAGGGTCAACTGGGAGG - Intergenic
959315801 3:104805091-104805113 CAGAGAAAGTGGCAGGTGATGGG + Intergenic
959748266 3:109803278-109803300 CAGGGAAAGTGGCTATCAGATGG - Intergenic
960348406 3:116563666-116563688 AAGGGAGAGTGGCAATTGGCAGG + Intronic
960750226 3:120941754-120941776 CAGTGAAGGGGGCAAATGGAAGG + Intronic
961000569 3:123371544-123371566 CAGGGGAAGTGGCACGCGGCCGG + Intronic
961031909 3:123613541-123613563 CAGCAAAACTGGCAGGTGGAAGG + Exonic
961158343 3:124700226-124700248 CAGGGAACTTGGCAGGTGCAGGG - Intronic
961367006 3:126406509-126406531 CAGGGAAAGAGACATGTGGCCGG - Intronic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
962453817 3:135546961-135546983 CAGGGAAAGGTGCAAGAGGAGGG - Intergenic
962655746 3:137542542-137542564 CAGGCAAAGTGGCATGGGGGAGG + Intergenic
963729411 3:148957048-148957070 CAGGGTACGTTGCAGGTGGAGGG - Intergenic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
964338364 3:155681783-155681805 CAGGGAAACTCCCAAGTGGATGG + Intronic
965120414 3:164547481-164547503 AAGTGTATGTGGCAAGTGGAAGG + Intergenic
966669355 3:182509368-182509390 CAGGGAAGGGGGCAAGTGGGAGG + Intergenic
967371051 3:188746537-188746559 CAGGGAGAGTGCAAAGTTGAAGG - Intronic
968790701 4:2659201-2659223 AATGAAAAGTGGCACGTGGAGGG - Intronic
972010086 4:34168074-34168096 AAGGAAACGTGCCAAGTGGAGGG + Intergenic
972190825 4:36588527-36588549 CAGGGAAAGGGGTAGGTGTAGGG - Intergenic
973211319 4:47618499-47618521 CAGGGAACGAGGTAAGTTGAGGG + Intronic
974761334 4:66278197-66278219 AATGGAAGGTGGAAAGTGGAGGG - Intergenic
976832954 4:89335711-89335733 AAGGCAAGGTGGCAGGTGGAGGG - Intergenic
977583108 4:98746469-98746491 CAGGCACAGTGGCAGGTGGCAGG - Intergenic
978757482 4:112319095-112319117 CTGGGAAAGAGACAAGTGGCAGG + Intronic
978807790 4:112818600-112818622 CAGGGAGAGGGGCAAGAGGGTGG + Intronic
979562957 4:122120609-122120631 CTGGGATAGAGGCATGTGGATGG + Intergenic
981661461 4:147171943-147171965 CAGAGAAAGGGGACAGTGGAAGG - Intergenic
982205075 4:152991586-152991608 CAGGGAAAGAGGGATGTGGGGGG + Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
985107639 4:186514634-186514656 CTGGGAAAGAGACAAATGGATGG + Intronic
985267994 4:188167769-188167791 AAGAGAAAGTGGTCAGTGGATGG + Intergenic
985577286 5:679300-679322 CAGGGAAAGGGGTGAGTGGGTGG - Intronic
985592201 5:771351-771373 CAGGGAAAGGGGTGAGTGGGTGG - Intergenic
986004011 5:3652528-3652550 CAGGGAAAGTGGGAAATGGGAGG + Intergenic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
988534134 5:32050951-32050973 CATGAAAAGTGGCTAGTGGGGGG + Intronic
988578136 5:32445609-32445631 CAGGAAGAGCAGCAAGTGGAAGG + Intergenic
988959262 5:36353255-36353277 CAGGACAGGCGGCAAGTGGAAGG + Intergenic
989156479 5:38349295-38349317 CAGGGAAGGTGTCAAAGGGAGGG + Intronic
990124585 5:52498390-52498412 CAGTGCAGGTGGCAAATGGACGG + Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
991047560 5:62238498-62238520 CAGGGGAACTGGGAAGTGAAGGG - Intergenic
991269960 5:64768252-64768274 CAGGGAAAGTGTATTGTGGAAGG - Intronic
992149535 5:73889316-73889338 CAGTTAAAGTAGCAAGAGGATGG + Intronic
993126150 5:83838188-83838210 CGGGGAAAGTGGAAAGAGCACGG - Intergenic
995190241 5:109311858-109311880 TAGGGCAAGGGGCAAGGGGAGGG + Intergenic
996020636 5:118587439-118587461 CAGGGAAAGTGTCCAGTGAAGGG + Intergenic
996472250 5:123874565-123874587 CACTGGAAATGGCAAGTGGATGG + Intergenic
996627328 5:125586105-125586127 CAGAGAAAGAGGGAAGAGGAGGG + Intergenic
996960991 5:129249432-129249454 CAGGGTAGGAGGCAAGGGGACGG + Intergenic
997530100 5:134576739-134576761 CAGGGAAAGTGAGAGGAGGAGGG - Intronic
997567701 5:134902314-134902336 GAGGGAAAGTGAAAAGGGGAAGG + Intergenic
998479377 5:142449255-142449277 CAGGGAGAGTGGAAAGTTGAGGG + Intergenic
999412583 5:151365407-151365429 CAGGGAAAGTGGCCAGTTCAGGG + Intergenic
1000123066 5:158216432-158216454 CAGGGAGAGGGGCAAGGGGAGGG - Intergenic
1000486483 5:161850619-161850641 AAGGGAAAGTGGAGAATGGATGG + Intronic
1000976406 5:167769650-167769672 CAGGAAAAATGGGAAGTTGAAGG - Intronic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1002398415 5:178976092-178976114 CAGGCGGAGTGGCAAGTGCAAGG - Intergenic
1003099242 6:3164478-3164500 CAGCGAATGTGGAAAGGGGAAGG + Intergenic
1005695184 6:28345216-28345238 CTGGGAAAGAGTCATGTGGATGG + Intronic
1005817765 6:29570118-29570140 CAAGGAAAGAGGCAAGTGGAAGG + Intronic
1006106562 6:31720363-31720385 CAGGGAAAATGGAAAGTGGGCGG + Intronic
1006169595 6:32085438-32085460 CAAGGAAAGCTGCAGGTGGAGGG + Intronic
1006831401 6:36970371-36970393 TAGGTAGAGTGGCAAGTAGAGGG + Intronic
1006854909 6:37125945-37125967 AAGGGAAGGGGGCAAGTGGCGGG - Intergenic
1007353714 6:41294629-41294651 CTGGTAAAGTGGCATGGGGAAGG - Intergenic
1007449138 6:41930105-41930127 GAGGGGAAGTGCCAAGAGGAGGG - Intronic
1008534922 6:52500398-52500420 CAGGGAGGGTGGCAGGGGGAGGG + Exonic
1010365717 6:75049276-75049298 TAGGGAAATAGGCAAGGGGATGG - Intergenic
1011004645 6:82630301-82630323 AAGGAAAAGTGCCAAGTGAAGGG + Intergenic
1011184488 6:84659077-84659099 TATGGAAAGGGGTAAGTGGAAGG + Intergenic
1014672388 6:124321518-124321540 CAAGGTAAGTGGCTAATGGAAGG + Intronic
1015114148 6:129628391-129628413 CAGGCAAAGTTACAAATGGATGG + Intronic
1016088273 6:139942989-139943011 CAGGGAAGGTGGCAAATGCCAGG - Intergenic
1016548498 6:145250684-145250706 CAGGTACAGTGACAACTGGAAGG - Intergenic
1016683964 6:146860776-146860798 CAGGGACAGAAGCCAGTGGAGGG - Intergenic
1017821280 6:158050669-158050691 CAGGGAATGTGGCAAGCAGACGG - Intronic
1018036471 6:159886865-159886887 CAGGGAAAGAGGGGAGAGGAAGG + Intergenic
1018151586 6:160944826-160944848 CAGGGAATGTGGGAACTTGACGG + Intergenic
1019025618 6:168960517-168960539 GAGAGAAAGTGGGAAGCGGATGG + Intergenic
1019575914 7:1737584-1737606 CAGGGAACGTTGAAGGTGGAGGG - Intronic
1019678401 7:2329736-2329758 CCTGGAAAGTGGCACGGGGAGGG + Intronic
1020447622 7:8285886-8285908 TAGGGAGGGTGGCATGTGGAGGG + Intergenic
1021121982 7:16806300-16806322 CACTGAAAGTAACAAGTGGATGG + Intronic
1023083881 7:36550747-36550769 TATGGAAAGGGGCAACTGGATGG - Intronic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1027175162 7:75898842-75898864 CAGGGTAAGTGGCAATTGTCAGG + Intergenic
1030324575 7:108205580-108205602 CAGTGAAACTGACAAGTGGAAGG - Intronic
1030553660 7:110996292-110996314 ATGGGAAAGTGGCCTGTGGAGGG + Intronic
1031554837 7:123161520-123161542 CAAGGAAAGGAGAAAGTGGAAGG - Intronic
1031915621 7:127560185-127560207 GAGGGAAAGTGGAAGGTGGAAGG - Intergenic
1031982269 7:128135728-128135750 CAGGGACCGAGCCAAGTGGAAGG + Intergenic
1033922647 7:146413322-146413344 CACAGCAAGTTGCAAGTGGAAGG - Intronic
1036611153 8:10350881-10350903 GAGGGGAAGTGGCAAGTCCAAGG + Intronic
1038429760 8:27491006-27491028 CCGGGAAAGAGGCAGGGGGAGGG - Exonic
1039946814 8:42136888-42136910 CAGAGACAGTGACAAGAGGAGGG + Intergenic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1040567317 8:48579362-48579384 CAGCTACAGTGGCCAGTGGAGGG + Intergenic
1040606523 8:48938366-48938388 CAGGGAAAGAGGAAAGTTGCAGG + Intergenic
1042112269 8:65393286-65393308 CAGGGAAAGGGTCAAGTGAGAGG + Intergenic
1042668994 8:71240190-71240212 CAAGGAAAGGGGCTTGTGGATGG - Intronic
1042976746 8:74478347-74478369 CAGGCAAAGTGGCAGGTGGGAGG + Intronic
1043160139 8:76836845-76836867 CAGGGAAAATGTAAAGTAGATGG + Intronic
1043335839 8:79175852-79175874 CAGGGAAGCTGGCAATTGCATGG - Intergenic
1043615505 8:82119826-82119848 AAGGTAAAGTGGAAAGTAGAGGG - Intergenic
1044536773 8:93365924-93365946 CAGGGATATTAGCAAGAGGATGG + Intergenic
1046519459 8:115305709-115305731 CACAGAAAGAGGCAATTGGAGGG - Intergenic
1047884239 8:129230938-129230960 CAGGGGAAGAGGCATGTAGATGG + Intergenic
1048268502 8:133009015-133009037 AGGGGACAGTGGCAGGTGGAGGG + Intronic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049043793 8:140132738-140132760 CTGGGAAAGGTGCAAGTGGGAGG + Intronic
1049202060 8:141345134-141345156 CAGGGGAAGAGGGAAGTGAATGG + Intergenic
1049254566 8:141606752-141606774 CAGGGCAGGTGGGAAATGGAGGG - Intergenic
1049805594 8:144537372-144537394 CAGGGAAGTTTGCAGGTGGAGGG - Intronic
1051765962 9:20524024-20524046 CAGGGGAAGTGGCAGGGAGAAGG + Intronic
1052277687 9:26696080-26696102 CATGGAAAGTGGGAAGTTGGTGG - Intergenic
1052738958 9:32375276-32375298 CAAGGACTGTGGCATGTGGAGGG - Intergenic
1053648510 9:40140084-40140106 CAAGGACAGTGCCAAGAGGATGG + Intergenic
1053757231 9:41323760-41323782 CAAGGACAGTGCCAAGAGGATGG - Intergenic
1054536071 9:66236086-66236108 CAAGGACAGTGCCAAGAGGATGG - Intergenic
1054762389 9:69014492-69014514 GAGGGAATGTGGGAAGTGGTGGG + Intergenic
1055271168 9:74560479-74560501 CAGGGAAAATGGCATGAGCAGGG + Intronic
1056566293 9:87775669-87775691 AAGGGCATGTGACAAGTGGAGGG + Intergenic
1059487226 9:114636063-114636085 CAGAGGAGGTGGCCAGTGGATGG + Intronic
1060241383 9:121906668-121906690 AAGGGAAAGGGGAAAGGGGAAGG + Intronic
1060245193 9:121939928-121939950 CAGGGAAAGAGGCTGGGGGAGGG + Intronic
1060421268 9:123471354-123471376 CATGGAAAGTGCCTAGTGGGGGG + Intronic
1060470719 9:123945885-123945907 CAGGGAAAAGGGCGAGGGGAAGG + Intergenic
1060811017 9:126611572-126611594 CAGGGAAGGTGGGGAGGGGATGG + Intergenic
1060990539 9:127846443-127846465 CAGGGAAAGTCCCAAAGGGAAGG - Intronic
1061042968 9:128150241-128150263 CAGGGGAAGTGGTATGTGGTAGG + Exonic
1061401833 9:130372763-130372785 CAGGGACAATCGAAAGTGGAAGG + Intronic
1061791433 9:133061285-133061307 GAGGGAAAGAGGCCAGTGGGAGG - Intergenic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062146995 9:134995038-134995060 CAGGGACAGTGCCAAGTGAATGG + Intergenic
1062233871 9:135498863-135498885 CAGGGACAGTGGCAAGCAGAGGG - Intronic
1202796274 9_KI270719v1_random:123381-123403 CAAGGACAGTGCCAAGAGGATGG + Intergenic
1186331234 X:8536374-8536396 CAGGGACATTGGCAAGGAGATGG + Intronic
1186432849 X:9519768-9519790 CTGGGAGAGTGGCAAGGAGAGGG + Intronic
1189592576 X:42530686-42530708 CAGGCAAAGTGAGAAGAGGAAGG - Intergenic
1189681165 X:43518227-43518249 CACTGCAAGTGGGAAGTGGAGGG - Intergenic
1189860293 X:45264584-45264606 CAGAGAAAGTGGTAAGGGAATGG - Intergenic
1190495268 X:51022493-51022515 CATTGAAAGTGGCAAGGGGAAGG + Intergenic
1190510792 X:51172154-51172176 CATTGAAAGTTGCAAGGGGAAGG - Intergenic
1190980910 X:55455974-55455996 CAGGGAAAGGGGCTTCTGGAAGG + Intergenic
1190987787 X:55517206-55517228 CAGGGAAAGGGGCTTCTGGAAGG - Intergenic
1192018040 X:67353012-67353034 AAGGGCAAATTGCAAGTGGAGGG - Intergenic
1192173978 X:68874515-68874537 CAGGGGAATTGGTAAGGGGAGGG + Intergenic
1192259722 X:69497966-69497988 CAGGCAAAGTGGCTAGAGGTAGG + Intergenic
1192659879 X:73030792-73030814 CAGGCAAAGTGGCATGAGGGAGG - Intergenic
1192681402 X:73257474-73257496 AAGGGAAAGTGGGAAGTTGTGGG - Intergenic
1192983039 X:76367287-76367309 CAGGCAAAGTGGCTTGGGGAAGG + Intergenic
1193667515 X:84340104-84340126 AAGGGAAGGTGGGAGGTGGAAGG + Intronic
1194156112 X:90391255-90391277 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1194344883 X:92751197-92751219 CAGGGAAAGTGGCATGGGGGAGG + Intergenic
1195394755 X:104398785-104398807 CAGGGCAAGTGACAAGCAGAGGG + Intergenic
1196041738 X:111211999-111212021 CAGGGATAGAGAGAAGTGGATGG + Intronic
1196962809 X:121022258-121022280 CAGGGAAAGAGAGAAGTGCACGG + Intergenic
1197658923 X:129148912-129148934 GAGGAAAAGTGGGCAGTGGAAGG + Intergenic
1199099474 X:143781804-143781826 CTGGGAAACTGGCAAGTAAAGGG - Intergenic
1199818138 X:151418636-151418658 GAGGGAAAATGGCAAGTAAATGG + Intergenic
1200502458 Y:3968228-3968250 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1200653224 Y:5867839-5867861 CAGGGAAAGTGGCATGGGGGAGG + Intergenic
1201849533 Y:18462737-18462759 CAGAGAAGATGGCAAGTGGCTGG - Intergenic
1201883785 Y:18857638-18857660 CAGAGAAGATGGCAAGTGGCTGG + Intergenic