ID: 1146266914

View in Genome Browser
Species Human (GRCh38)
Location 17:31458791-31458813
Sequence CAGGGTGTGAAACACGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146266902_1146266914 27 Left 1146266902 17:31458741-31458763 CCAGCATCTTTGTCACATTAGTG 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1146266914 17:31458791-31458813 CAGGGTGTGAAACACGTTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1146266909_1146266914 -9 Left 1146266909 17:31458777-31458799 CCTTGTGGGTCACCCAGGGTGTG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1146266914 17:31458791-31458813 CAGGGTGTGAAACACGTTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146266914 Original CRISPR CAGGGTGTGAAACACGTTTG GGG Intronic
901849177 1:12004651-12004673 CAGGGGTTGAATCACTTTTGGGG - Intronic
903215774 1:21842644-21842666 CAGGGGATAAAATACGTTTGCGG - Intronic
906953262 1:50351144-50351166 CAGGGTGTGAAGCAGGGGTGTGG - Intergenic
910432106 1:87168935-87168957 CAGGGTGTTAAACATTTTTCAGG - Exonic
910784666 1:90983425-90983447 CAGGGTGTGGAAGTCTTTTGTGG - Intronic
918704469 1:187642966-187642988 AAGGCTGTCAAACATGTTTGAGG - Intergenic
921466820 1:215498237-215498259 CAGGGGCTGAGAAACGTTTGTGG - Intergenic
1073600141 10:104838622-104838644 CAGGGAGTGGGACACGTATGAGG - Intronic
1075409839 10:122219240-122219262 AAGGGTGTGAAACAGGGATGAGG - Intronic
1080991891 11:37546413-37546435 CAGGGTGTGGAACAGTTTAGAGG - Intergenic
1082887768 11:58106077-58106099 AAGGGGGTGGAACATGTTTGTGG - Intronic
1083242041 11:61395915-61395937 CAGGTTGTTATACACTTTTGTGG + Intronic
1085763371 11:79261321-79261343 CAGGGTTTGGTACAGGTTTGTGG - Intronic
1086244935 11:84740794-84740816 GAGGGTGTGAAACAGATTGGCGG - Intronic
1086405769 11:86497888-86497910 CAGGGTGAGGAGCATGTTTGTGG - Intronic
1087474522 11:98619679-98619701 CAGGGGTTGAAACAGTTTTGAGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090540672 11:127699987-127700009 CAGGATGTGAAACAGGGGTGTGG + Intergenic
1092578374 12:9814136-9814158 CGGGGTGTAGAACACCTTTGGGG - Intergenic
1094374165 12:29772840-29772862 TAGTGTATGAAAAACGTTTGAGG - Intronic
1100723381 12:97382807-97382829 CAGGGGGTTCAAGACGTTTGTGG - Intergenic
1104803766 12:131572098-131572120 CAGGGTAAGATACACGTGTGGGG + Intergenic
1107536010 13:41333403-41333425 CAGGGAGTGAAATAGGTATGGGG - Intronic
1109302087 13:60600156-60600178 CAGGGTGTGGTACACGTGTGAGG - Intergenic
1111653055 13:91116786-91116808 GAGGGTGGGAAAGATGTTTGGGG - Intergenic
1112058742 13:95716241-95716263 CAGGGCGTGCAACAGGGTTGTGG + Intronic
1113017553 13:105844803-105844825 CAGGATGGAAAACAAGTTTGGGG - Intergenic
1115308013 14:31951811-31951833 CAGGGTGTCAAACAGGTTGGAGG - Intergenic
1120128251 14:80772774-80772796 CAGGATGTGCAACAGGGTTGTGG - Intronic
1121404726 14:93712741-93712763 CAGGGTGTGCAGGACCTTTGTGG + Intergenic
1130883764 15:88076790-88076812 CAGGTTTTAAAACACTTTTGAGG + Intronic
1137457437 16:48628791-48628813 CAAGGTGTTAAACTTGTTTGGGG + Intergenic
1139574087 16:67830478-67830500 CAGGGAGTGATACACGTTGGGGG + Exonic
1141765802 16:86059504-86059526 CAGGGTGTGAGACACCCTTTAGG + Intergenic
1146266914 17:31458791-31458813 CAGGGTGTGAAACACGTTTGGGG + Intronic
1148388201 17:47251759-47251781 CATGATGTGAAGCAGGTTTGGGG - Intergenic
1151116403 17:71740260-71740282 CAGGGGGTGAATCAGGTTTCAGG - Intergenic
1151379995 17:73719327-73719349 CTGGGAGAGAAACAGGTTTGGGG + Intergenic
1151810581 17:76438519-76438541 AAAGGTGTGAAGGACGTTTGAGG - Intronic
1152754303 17:82080738-82080760 CAGGCTGTGGAACACGGTGGTGG + Exonic
1154214132 18:12403015-12403037 CAGGGTGTGAAGTAGATTTGAGG + Intergenic
1159417547 18:68172886-68172908 CAGGGTGTGCAACAGGGATGTGG + Intergenic
1159883632 18:73883793-73883815 CAGGCTGTGGAACACTTGTGAGG - Intergenic
1160094298 18:75857360-75857382 AATGCTGTGAAACACGTTAGGGG + Intergenic
1160996496 19:1884584-1884606 CAGGGTGGGAAACCCGCCTGGGG + Intronic
1162701175 19:12516062-12516084 CAGGTGGTGACACAGGTTTGGGG - Intronic
1164490707 19:28711459-28711481 CTGGGAGAGAAACAGGTTTGGGG + Intergenic
1165915183 19:39254289-39254311 CAGGTTGTGAAACAGGGTTTAGG + Intergenic
1167212133 19:48139858-48139880 GAGGCTGTGAAACAGGGTTGAGG - Intronic
925305055 2:2842420-2842442 CAGGCTCTGAAACTCCTTTGAGG - Intergenic
938576133 2:132606415-132606437 CAGGGTGTGCAACAGGGGTGTGG + Intronic
939101408 2:137898572-137898594 CAGGGAGTGACAAACGGTTGAGG - Intergenic
939690815 2:145258215-145258237 CAGGGGGTTAAAAAAGTTTGGGG - Intergenic
939998003 2:148938417-148938439 CAGGGACTGTAACAGGTTTGGGG - Intronic
942735132 2:179101745-179101767 AATGGTTTGAAACAGGTTTGTGG + Exonic
946003840 2:216506119-216506141 CAGAATATGAAACACTTTTGAGG + Intronic
946403194 2:219479646-219479668 AAGGGGCTGAAACAGGTTTGGGG - Intronic
947357532 2:229312429-229312451 CATGGTGTCAAACAGGATTGAGG - Intergenic
1168785719 20:538408-538430 CAGGGTATGAAAGACTTTAGAGG - Intronic
949775170 3:7624696-7624718 CAGGGTATGAAGCATGTTAGGGG + Intronic
953689280 3:45104092-45104114 GTGGGTGTGAAACACTATTGTGG + Intronic
962482514 3:135809962-135809984 CAGGATGTGCAACAGGTGTGTGG + Intergenic
962751609 3:138437876-138437898 CAGGATGAGAAACAGGTCTGGGG + Intronic
962924206 3:139976760-139976782 GAGGGTGTGAAACACGCTGAGGG + Intronic
965220526 3:165921117-165921139 CAGGGCTTGAAACATGTCTGGGG + Intergenic
965856955 3:173101235-173101257 GAGGGGGTGAAACATGCTTGGGG - Intronic
967122214 3:186392234-186392256 CAGGTTGGGAAAAACTTTTGTGG + Intergenic
969383734 4:6827756-6827778 CAGGGTTATAAACACATTTGTGG + Intronic
973771152 4:54208119-54208141 CAGGATTTGAAACAGTTTTGTGG + Intronic
974186469 4:58454086-58454108 CAGGATGTGACACAGGGTTGTGG + Intergenic
974523766 4:63020715-63020737 GAGGGTGTGAAATAAGTTCGAGG - Intergenic
976768154 4:88620365-88620387 CAGGGTAAGAAACAGGTTTAAGG - Intronic
977295780 4:95207181-95207203 CAGGGTTTTAAATACTTTTGTGG + Intronic
977804378 4:101279291-101279313 CAAGGTGAGAAACAAGTTTGGGG + Intronic
986248692 5:6034714-6034736 CATGGTGTGAAACACAAATGTGG - Intergenic
986370791 5:7078138-7078160 CAGAGAGTGAAACAACTTTGTGG + Intergenic
987925334 5:24333956-24333978 CAGAGTTTGAAAGAGGTTTGTGG - Intergenic
988088478 5:26503404-26503426 CAGGGAGGGAACCAAGTTTGGGG - Intergenic
992921524 5:81527487-81527509 CAGGGTATCAATCAAGTTTGAGG + Intronic
996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG + Intergenic
998037147 5:138926793-138926815 CAGCCTGTGAAACACGGGTGTGG + Intronic
998253324 5:140567114-140567136 CAGGGATTGCAACACGTTTGGGG - Exonic
1000396872 5:160785038-160785060 AAGGGTGTGTAACACATTTCTGG + Intronic
1002398837 5:178979548-178979570 CAGAGTGTGAAAGTCGTCTGCGG + Exonic
1002454631 5:179339074-179339096 CAGGGTGGTGAACACGGTTGTGG - Intronic
1004398410 6:15266715-15266737 CAGGGTGAGAAACAGCTTTGTGG + Intronic
1004569409 6:16831082-16831104 AAGGGTGGGAAACACCTTTATGG + Intergenic
1006166254 6:32067549-32067571 CAGGGTGTATTACAGGTTTGAGG + Intronic
1007513156 6:42390327-42390349 GTGAGTGTGAAACAAGTTTGGGG - Intronic
1009059629 6:58382840-58382862 CAGTATTTGCAACACGTTTGTGG + Intergenic
1009231281 6:61064576-61064598 CAGTATTTGCAACACGTTTGTGG - Intergenic
1010438742 6:75867084-75867106 CAGCGTGGGAAACAAGTTTAAGG + Exonic
1010911921 6:81569215-81569237 CAGGATGTGGAATAGGTTTGAGG - Intronic
1011085719 6:83538230-83538252 CAGTGTATGAAACATCTTTGGGG - Intergenic
1013829869 6:114258465-114258487 AATGCTGTGCAACACGTTTGGGG + Intronic
1019350351 7:551515-551537 CAGGGTGGGACACACGTGAGGGG + Intronic
1022192821 7:28033530-28033552 GAGGGTGTGGAGCAGGTTTGGGG + Intronic
1024397973 7:48890556-48890578 CAGGGTTTGAAAGATGCTTGGGG - Intergenic
1029101186 7:98131412-98131434 CAGGCTGTGAAAAACACTTGGGG - Intronic
1034523269 7:151637443-151637465 CAGTCTGTGAACCACTTTTGCGG - Intronic
1035011045 7:155715055-155715077 CAGGGTGGGAAAAACTTTGGGGG - Intronic
1042975795 8:74467710-74467732 CAGGGTGTTAAACAAGATAGTGG + Intronic
1045418339 8:101989337-101989359 AAGGGTGAGAAACAATTTTGTGG - Intronic
1047586579 8:126280060-126280082 CAGGGTGTGCAACAGGGATGTGG - Intergenic
1049788862 8:144463905-144463927 CAGGGTCCCAGACACGTTTGGGG - Intronic
1050891897 9:10835209-10835231 CAGGGTCTGAAACATGGTTCAGG - Intergenic
1052093545 9:24357905-24357927 CAGGGTTTGAAACAGTTTGGAGG - Intergenic
1055700704 9:78942861-78942883 CAGGGTGTGAAGAACTTTGGTGG - Intergenic
1057845513 9:98519506-98519528 CAAGGAGTGATATACGTTTGAGG - Intronic
1185809066 X:3088267-3088289 CAGGGTGTGACCCTAGTTTGAGG + Intronic
1189153006 X:38726718-38726740 CAGGATGTGAAACAAGATGGAGG - Intergenic
1190178137 X:48168222-48168244 CAAGGAGAGAAACACATTTGTGG - Intergenic
1190193025 X:48293433-48293455 CAAGGAGGGAAACACATTTGTGG + Intergenic
1190659534 X:52642042-52642064 CAAGGAGAGAAACACATTTGTGG + Intergenic
1190665762 X:52694876-52694898 CAAGGAGAGAAACACATTTGTGG + Intronic
1190673656 X:52763534-52763556 CAAGGAGAGAAACACATTTGTGG - Intronic
1190677196 X:52792302-52792324 CAAGGAGAGAAACACATTTGTGG - Intergenic
1195680553 X:107542877-107542899 TAGGGAGTGAATCAGGTTTGGGG - Intronic
1198299087 X:135317289-135317311 GAGGCTGTGAAACAGTTTTGCGG + Intronic
1198883469 X:141306909-141306931 CAGGGTGTGCAACAGGGGTGTGG - Intergenic