ID: 1146267955

View in Genome Browser
Species Human (GRCh38)
Location 17:31465480-31465502
Sequence CTGCAGCCCCTCAATACGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146267951_1146267955 4 Left 1146267951 17:31465453-31465475 CCCACATTACAACTCACCATTCA 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1146267955 17:31465480-31465502 CTGCAGCCCCTCAATACGGATGG 0: 1
1: 0
2: 0
3: 5
4: 74
1146267952_1146267955 3 Left 1146267952 17:31465454-31465476 CCACATTACAACTCACCATTCAA 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1146267955 17:31465480-31465502 CTGCAGCCCCTCAATACGGATGG 0: 1
1: 0
2: 0
3: 5
4: 74
1146267950_1146267955 24 Left 1146267950 17:31465433-31465455 CCGGGACTCTGTGCTTCAATCCC 0: 1
1: 0
2: 3
3: 14
4: 211
Right 1146267955 17:31465480-31465502 CTGCAGCCCCTCAATACGGATGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146267955 Original CRISPR CTGCAGCCCCTCAATACGGA TGG Intronic
900642798 1:3695397-3695419 CTCCAGCCCCTCCATAGAGAGGG - Intronic
904974184 1:34443138-34443160 CTGCAGCCCCTCAAGTCAGATGG - Intergenic
906764951 1:48420438-48420460 CTGCAGCCCCTAAAGACAGCAGG - Intronic
915079667 1:153343417-153343439 CTGCAGCCTCTGAAAAGGGAAGG - Intronic
921818752 1:219593033-219593055 TTGCAGCCCCTTAATATGGCTGG + Intergenic
921868450 1:220110979-220111001 ATGCAGCCCCTTTATACTGAGGG - Intronic
1065998636 10:31083718-31083740 CCCCAGCCCCTCAAAACGTAGGG + Intergenic
1066655078 10:37690673-37690695 CTGCAGACCCTGAAGACTGAAGG + Intergenic
1067040129 10:42946764-42946786 CTGCAGACCCTGAAGACTGAAGG + Intergenic
1067575533 10:47406249-47406271 CTGCAGCCCCACAGTGGGGAAGG - Intergenic
1069938568 10:71937308-71937330 CTGCACCACCTCAAGACTGAAGG + Intergenic
1070758059 10:79005759-79005781 CTGCAGCCCCTCATTTCTGGTGG + Intergenic
1071295180 10:84214290-84214312 CTTGAGCCACTCAATGCGGATGG - Exonic
1078428636 11:11270573-11270595 CTGCAGCCCTTCATTCCTGAGGG - Intergenic
1082755666 11:57073702-57073724 CTGCAGCCCCTCAGGACTGCTGG - Intergenic
1083633075 11:64105652-64105674 CTGCAGCCCCTCAAGCCTGTGGG - Intronic
1083762756 11:64827589-64827611 GTGCGGCCCCTCAATCCAGAGGG - Exonic
1091001059 11:131911027-131911049 CTGCAGTCCCTCAGTTCGAACGG - Intronic
1092170722 12:6372441-6372463 CAGCAGCCCTTCAAGAAGGAGGG + Intronic
1094257758 12:28454506-28454528 CTGCAGCCTCTCCCTAGGGAGGG - Intronic
1095277892 12:40311151-40311173 CAGCTGCCTCACAATACGGAGGG - Intronic
1095954263 12:47797473-47797495 CTGGAGCCCCTGGAGACGGAAGG - Exonic
1107750844 13:43564834-43564856 CTGCAGCCCCTGACTACAAATGG + Intronic
1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG + Intergenic
1117339491 14:54781354-54781376 CAGCAGCACCTCATTAGGGATGG + Intronic
1117951897 14:61091138-61091160 CTCCAGCACCTCATTAAGGAGGG + Intergenic
1125656895 15:41365402-41365424 CAGCAGCCCATCAATAAGGGAGG + Exonic
1125684348 15:41554809-41554831 CGGCAGCCCCTGATTATGGATGG - Intergenic
1126054657 15:44718792-44718814 GTGGAGCCCCTGGATACGGAAGG + Exonic
1126747066 15:51836846-51836868 CTGCACCCACTCACTAAGGAAGG + Intronic
1127763734 15:62165067-62165089 CTGCAGCCCCTCGACGCGGCTGG + Intronic
1132796710 16:1728036-1728058 CTGCAGCCCACCAATGGGGAGGG - Intronic
1135752988 16:25071778-25071800 CTGCATCCCCTCCATTCGGGTGG - Intergenic
1139268916 16:65663923-65663945 CTCCAGCCCCTCTAGACTGAGGG + Intergenic
1142245694 16:88969161-88969183 CTGCAGCCCCTCACTCCAGATGG - Intronic
1143086797 17:4422115-4422137 CTGCTGCCCCTCCATGTGGAAGG - Intergenic
1146267955 17:31465480-31465502 CTGCAGCCCCTCAATACGGATGG + Intronic
1146416051 17:32634326-32634348 CTGCAGCATCTCAACAAGGAGGG + Intronic
1153700094 18:7683998-7684020 CTGCAGGCCCTGAAGAGGGAGGG - Intronic
1158410756 18:57203860-57203882 CTGCAGCTACTTAATACTGAGGG + Intergenic
1161676826 19:5655596-5655618 CAGCAGCCCCTCCTTAAGGAAGG + Intronic
1162566721 19:11448750-11448772 CTGCTCCCCCTCAATATGGAAGG - Intronic
927911006 2:26899684-26899706 CTGCAGCCCCTGGATTGGGAAGG - Intronic
935648665 2:105363455-105363477 CTGCAGCCCATCACCACGGGAGG - Exonic
935986541 2:108679014-108679036 ATCCAGCCCCTGGATACGGAGGG - Intronic
936138985 2:109922676-109922698 ATCCAGCCCCTGGATACGGAGGG - Intergenic
936205711 2:110448809-110448831 ATCCAGCCCCTGGATACGGAGGG + Intronic
946639236 2:221765661-221765683 CTGCAGTCCCTCAATGCTGATGG + Intergenic
948806276 2:240454565-240454587 CCGCAGCCCCCCAACACGCAAGG - Intronic
1169932458 20:10849080-10849102 CAGCAGCCCCTCTATACAGGGGG - Intergenic
1175385328 20:58591291-58591313 CTGCAGCCCCCCACTTCAGAGGG - Intergenic
1179727042 21:43346548-43346570 CTGCATCCCCTCATTCCAGAGGG + Intergenic
1181005958 22:20013636-20013658 CGGCAGCCCCTCAATCAGCAGGG + Intronic
1184278256 22:43422679-43422701 CAGCAGCTCCTCAATATGCAAGG + Intronic
1184483300 22:44760808-44760830 CTGCAGCCCCTCATTAGACATGG - Intronic
953743589 3:45556783-45556805 CTGCAGCCCCTAGATACTCAGGG + Intronic
966351402 3:179035957-179035979 TTGTAGCCCCTCAACACAGAAGG - Intronic
968867330 4:3221747-3221769 ATGCAGCTCATCAATAGGGATGG + Intronic
985880181 5:2633469-2633491 CTCCACCCCCTCAAAATGGATGG - Intergenic
995626065 5:114077520-114077542 CTGCAGCCCCTCAAGACCCAGGG - Intergenic
1000611280 5:163378072-163378094 CTACAGCCCCTCCTTAGGGAAGG - Intergenic
1003560607 6:7176726-7176748 GTTCAGCCCCCCAATAAGGAGGG + Exonic
1007574483 6:42916199-42916221 CTGCAGCCCATCAGTACCCAGGG - Intronic
1008640042 6:53453137-53453159 CAGCAGGCCCTAAATAGGGAAGG + Intergenic
1009566928 6:65321613-65321635 TTGCAGCCCCTTAATATGGCTGG - Intronic
1022664821 7:32400807-32400829 CTGCAGGGCCACAATACAGAAGG + Intergenic
1026177505 7:68010671-68010693 CTGCTTCCCCTCAAGACAGAAGG - Intergenic
1026573931 7:71556142-71556164 CTGTAGCCCTTAAATACGCAAGG + Intronic
1029272519 7:99385573-99385595 CTGCTGCCCCTCTAAACTGAGGG + Intronic
1034750319 7:153562196-153562218 CTGCAGCCCCTGCTTACCGAGGG + Intergenic
1043991867 8:86765387-86765409 TTTCAGCCCCTGAATAAGGAGGG - Intergenic
1046779310 8:118198013-118198035 CTGCAGCCCCGCCATAGGGCTGG - Intronic
1049154768 8:141059772-141059794 CCGCAGCCCCTGAAGCCGGAGGG + Intergenic
1050921743 9:11212404-11212426 CTGCAGTTCCTCAATAAGGTGGG - Intergenic
1051213748 9:14774345-14774367 CTGAAGCCCCCCAAAAAGGAAGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055520877 9:77080026-77080048 CTTCAGCCCCTGAAAAAGGAGGG + Intergenic
1056724943 9:89106531-89106553 CTGCCTCCCCTCACTACTGAAGG - Intronic
1061508351 9:131045546-131045568 CTGCAGCCCCACAATCCAGCTGG + Exonic
1062046805 9:134428229-134428251 CAGCAGCCCCTCAACACAGTGGG - Intronic