ID: 1146268723

View in Genome Browser
Species Human (GRCh38)
Location 17:31470548-31470570
Sequence AAGCAGGAATGGATGATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146268720_1146268723 -8 Left 1146268720 17:31470533-31470555 CCACAGGCCTGGCAGAAGCAGGA 0: 1
1: 1
2: 6
3: 56
4: 491
Right 1146268723 17:31470548-31470570 AAGCAGGAATGGATGATACATGG 0: 1
1: 0
2: 0
3: 25
4: 296
1146268718_1146268723 -7 Left 1146268718 17:31470532-31470554 CCCACAGGCCTGGCAGAAGCAGG 0: 1
1: 0
2: 3
3: 56
4: 343
Right 1146268723 17:31470548-31470570 AAGCAGGAATGGATGATACATGG 0: 1
1: 0
2: 0
3: 25
4: 296
1146268717_1146268723 -6 Left 1146268717 17:31470531-31470553 CCCCACAGGCCTGGCAGAAGCAG 0: 1
1: 0
2: 7
3: 49
4: 578
Right 1146268723 17:31470548-31470570 AAGCAGGAATGGATGATACATGG 0: 1
1: 0
2: 0
3: 25
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146268723 Original CRISPR AAGCAGGAATGGATGATACA TGG Intronic
900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG + Intronic
900869174 1:5289630-5289652 ATGGATGGATGGATGATACATGG + Intergenic
902424339 1:16307603-16307625 AAGCAAGATTGCAGGATACAAGG + Intronic
902692306 1:18117563-18117585 AAGCGTGAATGGATAATACCAGG + Intronic
903291035 1:22314450-22314472 ATGCAGGAATGAATGATTCCTGG - Intergenic
904342688 1:29847394-29847416 AAGTAGGAATGAATGAACCAAGG - Intergenic
904581246 1:31545770-31545792 AAAGACGAATGGATGATGCATGG - Intergenic
905402199 1:37711951-37711973 ATGCAGGTAGGGATGATACAGGG - Intergenic
905522866 1:38613827-38613849 AAGCATGAATGTAGGAGACAAGG - Intergenic
907260060 1:53211308-53211330 AAGCAGCAATGGGTGAGGCAGGG + Exonic
908689981 1:66768106-66768128 TAAAAGGCATGGATGATACATGG + Intronic
910037587 1:82806330-82806352 AACCAGGAATGGATTATGCTTGG + Intergenic
910656566 1:89625385-89625407 AAGCTGGAATTGATGAGACCTGG - Intergenic
912549203 1:110473703-110473725 ATGAAGGAATGGGTGACACAGGG + Intergenic
914250037 1:145914510-145914532 TTGCAGGAAAGAATGATACAAGG - Intronic
915359651 1:155278188-155278210 AAGCAGGACTGGAGGAGGCAGGG - Intronic
916901191 1:169225488-169225510 AAGTAGGAATGGCTGTTTCATGG + Intronic
917031748 1:170700418-170700440 AAGCAGGAATTCAAGACACAAGG - Intronic
918302573 1:183217275-183217297 AAGCAGGGATGGATGAGATAGGG + Intronic
919160916 1:193830059-193830081 AACCAGAAATGGATAATAAATGG - Intergenic
919272555 1:195368073-195368095 TAGCAGGATTGCAGGATACATGG + Intergenic
921500864 1:215901302-215901324 AGGCAGCAATGGATGATATCGGG - Intronic
923250896 1:232178859-232178881 AAGCAGGAATGTTGGATACCTGG - Intergenic
923448291 1:234092966-234092988 AAGCATAAATGAATGAAACAGGG - Intronic
923597297 1:235370589-235370611 AAACAGTAATGGATTTTACAGGG - Intronic
1065639631 10:27768543-27768565 AAGCAGAAATGGAGGGTCCATGG - Intergenic
1066351689 10:34642215-34642237 AAGCAGCAAGGGATGACAGAGGG - Intronic
1066707903 10:38201333-38201355 AAGCAGAAAAGGATAATAAAAGG + Intergenic
1070376783 10:75840103-75840125 AAGTAGAATTGGATGATACAGGG - Intronic
1070693120 10:78542437-78542459 AAGCAGGAATAGATGTTATTTGG - Intergenic
1071767388 10:88683158-88683180 AAGCAGGAATGGAGGCAAGAAGG + Intergenic
1071871671 10:89802081-89802103 AAGCAGTATTGCATGCTACAGGG - Intergenic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1072040718 10:91603696-91603718 AAGCAGGAAGGGGTGATGCTGGG - Intergenic
1072798048 10:98371736-98371758 AGGCAGGCATGGAGGAGACATGG + Intergenic
1074018875 10:109563583-109563605 AAGGAGGAATGGAGGATGGAAGG - Intergenic
1074280670 10:112048633-112048655 AAGCAGGAAGGGATGGGAAAAGG + Intergenic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1077279669 11:1736978-1737000 AAGCAGGTATTGAGGATTCAGGG + Intronic
1078387154 11:10902670-10902692 AAGCAGGCATGAATGATCCTTGG - Intergenic
1078633291 11:13025806-13025828 AAGCATGACTGGATGATCCCTGG - Intergenic
1079636858 11:22753287-22753309 AAGCAGAAATGGAAGAAACAAGG - Intronic
1079938902 11:26653238-26653260 AAGCAGGATTGGATGAAATTCGG - Intronic
1081701583 11:45155796-45155818 AAGCAGAAAAGGAGGATCCAGGG + Intronic
1084282873 11:68110394-68110416 TAGCAGGACTGCAAGATACAAGG + Intronic
1085014541 11:73164690-73164712 AACCAGGTATGGATGTTACAAGG - Intergenic
1086371516 11:86159989-86160011 AAGCAGGAAGGGACTACACAAGG - Intergenic
1087026044 11:93650769-93650791 AAGCAAGAAAAGATGATGCAAGG + Intergenic
1087256910 11:95966213-95966235 AGGTAGGAATGGATGATAGTGGG + Intergenic
1088498609 11:110458942-110458964 ATGGATGGATGGATGATACATGG + Intronic
1089181709 11:116587804-116587826 ATGCAGGAGTGGCTGATGCATGG + Intergenic
1089242013 11:117089509-117089531 AAATAGAAATGGATGATATATGG - Intronic
1089684966 11:120140923-120140945 AGGCAGGGATAGATGTTACAGGG - Intronic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1089960993 11:122617169-122617191 CAGCAGGAAGGGGTGATACCAGG - Intergenic
1090115782 11:123971528-123971550 GAGCAGAAATGGATGAAATAGGG - Intergenic
1090249551 11:125241907-125241929 AAGGATGAATGTATGATTCAAGG + Intronic
1091440647 12:509905-509927 ATGCAGCAAGGGATGAAACAGGG - Intronic
1092006258 12:5072968-5072990 CAGTAGGAATAGATTATACATGG + Intergenic
1093024176 12:14231823-14231845 AGGGAGGAATGGATGGTAGAAGG - Intergenic
1093145416 12:15559603-15559625 ACAGAGGTATGGATGATACAAGG - Intronic
1093398919 12:18718735-18718757 AAGGATGAATGAATCATACAGGG - Intronic
1098760391 12:74417335-74417357 AAGCAGAAATAGATGATAAAAGG - Intergenic
1099791408 12:87339640-87339662 AAACAGGAATGGAGAATAAAGGG - Intergenic
1100771148 12:97923887-97923909 AAGCAGAAAAGGATCTTACATGG - Intergenic
1102267631 12:111501325-111501347 AAACAGGAATGGCTGAAAAAAGG + Intronic
1105830410 13:24159455-24159477 AAACAGGAATGGAAAGTACACGG + Intronic
1107187330 13:37538999-37539021 AAGCAGGGAAGGCAGATACAAGG + Intergenic
1107550311 13:41468389-41468411 GAGCAGGAAGGGAAGATAAAAGG - Intronic
1108678552 13:52759813-52759835 AAGCAGGAAGGGAAGAGAGATGG + Intergenic
1110416533 13:75259564-75259586 ATGCAGGAATGACAGATACAGGG - Intergenic
1110872699 13:80470885-80470907 AAGTAGTAAAGGAGGATACAAGG + Intergenic
1112134661 13:96563639-96563661 AAGCTGTAATGGGTGATACAGGG + Intronic
1117093451 14:52272928-52272950 GAGCAGGGATGGATGAGAGAGGG - Intronic
1117291622 14:54339804-54339826 CAGCGGGAATGGAGGATTCAGGG - Intergenic
1120331597 14:83100314-83100336 AAGCTGGAATGGCTGATAGAAGG - Intergenic
1120745967 14:88152176-88152198 CAGCAGGAATGGAGGAGGCAGGG + Intergenic
1121565514 14:94906653-94906675 AATCTGGAATAGATGATAGATGG + Intergenic
1122274284 14:100583493-100583515 AAATATCAATGGATGATACATGG - Intronic
1124452229 15:29805523-29805545 ATGAATGAATGAATGATACATGG - Intronic
1124650518 15:31470399-31470421 AAGCAGGAGTGCATGTCACAGGG - Intergenic
1127050315 15:55076346-55076368 AATGGGGAATGGATAATACAGGG - Intergenic
1127236569 15:57059421-57059443 AAGAATGAAAGGATGAAACAGGG - Intronic
1127439832 15:58995176-58995198 AAACATCAATGGATGCTACATGG - Intronic
1128231563 15:66039076-66039098 AAGGAGAAATGAATGATAAATGG + Intronic
1128955422 15:71937278-71937300 AAACAGCATTGGATGCTACAGGG + Intronic
1129468213 15:75736054-75736076 AAGCAGGGTTAGATGGTACATGG - Intergenic
1129719184 15:77868613-77868635 AAGCAGGATTAGATGGTACATGG + Intergenic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1132333883 15:101030721-101030743 AAGCAGGTATGGGTGTCACAAGG - Intronic
1133700259 16:8302048-8302070 AAGCATGAATGGCAGAGACAGGG - Intergenic
1133938024 16:10284393-10284415 AAGGAGGAATGGAGGATGGAAGG - Intergenic
1135688987 16:24521204-24521226 ACGCAGGTATGGATGATCCAAGG - Intergenic
1137368635 16:47883658-47883680 AGGAAGGAATGGATGGTAGAGGG - Intergenic
1138395025 16:56697510-56697532 ATGCAGGAATGGCAGATACAGGG + Intronic
1138648443 16:58442586-58442608 AGGAAGGAATGGGTGAGACAGGG + Intergenic
1138989097 16:62368685-62368707 AAGAAGGAATGAAGGATAGATGG + Intergenic
1139039376 16:62983603-62983625 AAGGAGGAATGGAGGGTGCAAGG + Intergenic
1139943857 16:70625215-70625237 AAGGAGGAATGGATGGTGGAAGG + Intronic
1140947090 16:79778994-79779016 GAGTAGGAAAGGATGATACCGGG + Intergenic
1141045999 16:80716629-80716651 ATGGATGGATGGATGATACATGG + Intronic
1141364071 16:83426131-83426153 GAGAAGGAATGGATGAAAGAGGG - Intronic
1142087492 16:88191670-88191692 AAGCAGGAATGAATGAAGGAAGG - Intergenic
1143152278 17:4815077-4815099 AAGGATGCATGGATGATGCAGGG + Intronic
1144197845 17:12912725-12912747 AAGCAGCAATGGAAGAAAGAAGG + Intronic
1146268723 17:31470548-31470570 AAGCAGGAATGGATGATACATGG + Intronic
1146289468 17:31597369-31597391 ATGCAGGAATGGATGTGACAGGG - Intergenic
1146429350 17:32775929-32775951 AAGCAGGTTTGGAAAATACATGG - Exonic
1146605376 17:34253144-34253166 AAGCATGACTGGATTATAAAGGG + Intergenic
1147433685 17:40392789-40392811 AAGGATGGATGGATGATAGATGG - Intronic
1147736529 17:42642303-42642325 ATGCAGGAAGGGATGAACCACGG - Intergenic
1150645761 17:66976570-66976592 AAGGAGGAATGGAAGATGCAGGG - Intronic
1150703542 17:67468230-67468252 AAGCAGGCATGTTTGAGACATGG + Intronic
1151011410 17:70501987-70502009 AATCAGAGCTGGATGATACATGG - Intergenic
1151091568 17:71445812-71445834 AAGTAGAAATGGAGGACACACGG + Intergenic
1152333463 17:79686507-79686529 AGGCAGGAATGGAAGAGCCACGG + Intergenic
1153103624 18:1502381-1502403 ATGAATGAATGAATGATACAAGG - Intergenic
1153471456 18:5451031-5451053 AGTCTGGAATGAATGATACAGGG - Intronic
1155246221 18:23912605-23912627 ACTCAGGAAAGGCTGATACATGG + Intronic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1157906551 18:51574520-51574542 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1158019216 18:52821523-52821545 AAGCCGGAATGAATGATGAAGGG - Intronic
1158549075 18:58419656-58419678 ATGCATGGATGGATGATGCATGG + Intergenic
1158549077 18:58419671-58419693 ATGCATGGATGGATGATGCATGG + Intergenic
1158595110 18:58809117-58809139 AAGCAGGACTAGATAATACAGGG + Intergenic
1159149671 18:64505145-64505167 AAGCTGGAATGGCTGGAACATGG - Intergenic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159301489 18:66576861-66576883 TAGCAGGGTTGGAGGATACACGG + Intronic
1159354020 18:67314025-67314047 AAGCAATAATGTATGTTACATGG + Intergenic
1160288571 18:77569530-77569552 AAGCAGGCATGGTTGTCACACGG + Intergenic
1160709602 19:544935-544957 AAGGAGGGATGGATGATGGATGG - Intronic
1160709644 19:545074-545096 AAGGAGGAATGGATGATGGATGG - Intronic
1160886162 19:1349376-1349398 ATGCAAGAATGAATGACACACGG + Intergenic
1161486272 19:4537485-4537507 AAGCATGGATGGATGAAACGGGG + Exonic
1162190678 19:8943929-8943951 AAGGAAGAATGGGTGATAGAAGG - Intronic
1162657509 19:12142417-12142439 AAGCAGAAAAGGAGGATGCACGG - Intronic
1165588691 19:36946160-36946182 AAGCAGGAATTGGTGTTTCAGGG + Intronic
1166223357 19:41379640-41379662 AAGAAGGAATGAAGGAAACAAGG + Intronic
1166348507 19:42182057-42182079 AAGCAGGAAGGGAAGAAACTGGG + Intronic
1166593672 19:44025669-44025691 AACCAGCAATGGAAGATAAACGG - Intronic
1167029727 19:46949909-46949931 AAACAGTAATGGATGAGACTGGG + Intronic
1167895162 19:52574685-52574707 AAACAGACATGAATGATACAGGG + Intronic
1168300229 19:55400855-55400877 AAGCAGGATCAGATGATTCAAGG + Exonic
925644433 2:6021361-6021383 GAGCAGGAAAGAATGATAGATGG - Intergenic
926315782 2:11708502-11708524 AGGCAGGAGTGGATCATGCAGGG + Intronic
926875187 2:17468292-17468314 AAGCAGGAATGGTGGTTACTGGG - Intergenic
928469279 2:31557620-31557642 GAGTAGGAATGGATGAGAAATGG + Intronic
929220722 2:39462529-39462551 ATGCAGCAATAGATAATACAGGG - Intergenic
931601454 2:64007606-64007628 AAGCAGTAATGGAAAATTCAGGG - Intronic
932011100 2:67977938-67977960 AAGCAGGAAGGACTGATAGAAGG - Intergenic
935059703 2:99596512-99596534 AAACAGGAATGGATGCTGAAGGG + Intronic
935189658 2:100766638-100766660 AAGAAGGAAAGGAAGACACAAGG + Intergenic
935891967 2:107688579-107688601 AGGCATGAATGGATGTTACCTGG + Intergenic
937915636 2:127097471-127097493 AAGCAGGCATGCATGGGACAGGG + Intronic
938947039 2:136222600-136222622 AAACAGGAATGCATGCTACAAGG + Intergenic
939070697 2:137537969-137537991 AAGGAGGAAAGAAAGATACATGG + Intronic
940518641 2:154714381-154714403 AAGCAGGGATGTAGGATATATGG - Intronic
941064798 2:160889863-160889885 GATCAGCAATGAATGATACATGG + Intergenic
942068600 2:172295053-172295075 AAGCAGGAAGGGATAGTAAAAGG + Intergenic
942613381 2:177764385-177764407 TTGAAGGAAGGGATGATACAAGG + Intronic
942620404 2:177839011-177839033 AAGAAGGAATAGAAAATACATGG + Intronic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
944513068 2:200483713-200483735 CAACAGGAATAGCTGATACAGGG + Intergenic
946229528 2:218282806-218282828 AAGCAGGAGTGGGTGGTACAGGG + Intronic
946683170 2:222239293-222239315 AAGCTGGAGTGGATGAGAAAGGG + Intronic
947054036 2:226079982-226080004 AAGCAGGAGTTGATGCTTCAAGG + Intergenic
948167905 2:235877458-235877480 AAGCAGGAAAGGAAGAGACTGGG - Intronic
948175454 2:235939323-235939345 AAGCAGGAACAGATCATACATGG - Intronic
1173270508 20:41530032-41530054 AAGAAGGAATGGAGCACACATGG + Intronic
1173670425 20:44795017-44795039 TAGCAGAACTGGATGATACTAGG - Intronic
1177100481 21:16893432-16893454 AAGCAGGAATGGAGGGTGGAAGG - Intergenic
1178904826 21:36628158-36628180 AAGCAGGATTGGATGGGATAGGG - Intergenic
1181600197 22:23947354-23947376 AAACAGGAGTGGAAGCTACAGGG - Intergenic
1181975087 22:26723200-26723222 AGTCAGGAATGTAAGATACAAGG + Intergenic
1181986050 22:26800524-26800546 AAGGAGGAGTGGAGGAGACAAGG + Intergenic
1183175921 22:36224728-36224750 AAGGAGGAAAAGTTGATACAAGG - Intergenic
1185018832 22:48361551-48361573 AAGAGTGAATGGATGATAGATGG + Intergenic
1185063944 22:48621322-48621344 AAGCAGGGATGGATGATGGATGG - Intronic
952426279 3:33177750-33177772 TAGCAGGATTGCAGGATACAAGG - Intronic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
952817118 3:37455204-37455226 AAGCAGGACTAGAAGATCCAGGG - Intronic
953263096 3:41359100-41359122 AAGCAGGACTTGCTGATGCAAGG + Intronic
953461297 3:43083170-43083192 AAGCTAGAATGTATGATACTTGG - Intronic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
953739372 3:45523864-45523886 AAGCAGAAATGGATGGCAAAGGG + Intronic
955384357 3:58467281-58467303 AAGCAGGGGAGGATGATAGATGG - Intergenic
957382970 3:79457885-79457907 AAGAAAGAAAGAATGATACAGGG + Intronic
957929991 3:86864824-86864846 AAGTAGGTATGAAGGATACATGG + Intergenic
958467725 3:94478524-94478546 AATCTGGAAAAGATGATACAAGG + Intergenic
959148086 3:102573834-102573856 GAGCAAGAAGGGAAGATACAGGG - Intergenic
959721389 3:109494106-109494128 AAGCAGGATTTTATGAGACATGG - Intergenic
960368118 3:116799142-116799164 AACCAGGAATGGAGGATGGATGG - Intronic
960876990 3:122306719-122306741 AAGCAGCAATTGACAATACATGG + Intergenic
963111993 3:141695743-141695765 AAGGAGGAATGGAGGATGGAAGG + Intergenic
963886878 3:150592983-150593005 AACCAGGAATGGATAACCCAGGG + Intronic
964062298 3:152538648-152538670 AATCATCAATGCATGATACAGGG + Intergenic
964655082 3:159057594-159057616 AAGTAGTAATGGATAATATAGGG - Intronic
965524778 3:169704199-169704221 AAGGAGAAGGGGATGATACAAGG + Intergenic
965625028 3:170676975-170676997 AAGGAGGAATGGAGGATGGAAGG + Intronic
966415677 3:179687314-179687336 CAGCAGGAATGGAGAAGACAGGG - Intronic
966493518 3:180554571-180554593 AAGCAAGAAGGAAAGATACAAGG + Intergenic
967005059 3:185376097-185376119 AAACAGGAATGAAGGAAACATGG + Intronic
967080082 3:186041973-186041995 TAGCTGGACTGGAAGATACAAGG - Intergenic
968754207 4:2406813-2406835 AAGCAGGAAAGGATGAGAAGAGG - Intronic
971871279 4:32242415-32242437 AAGCAGCAATGGATTCAACATGG - Intergenic
972583948 4:40419581-40419603 AAGAAGGAATGAATGATTGAGGG + Intergenic
973932463 4:55806858-55806880 AGGCAGGAAGAGATGACACAGGG + Intergenic
974500873 4:62700659-62700681 AATCAAGAAGGGATTATACAAGG - Intergenic
975416993 4:74116126-74116148 ATGCAGGTATGGAAGAGACAAGG - Intronic
977820789 4:101470847-101470869 AAACAGGATTGGATGATTAATGG + Intronic
979311456 4:119208912-119208934 AAGCAGGAACAGATCATTCAGGG + Intronic
979813764 4:125072734-125072756 AAGATGGAATTGATGATCCAAGG - Intergenic
980819382 4:137993981-137994003 AATCAGGAATGCATTATAAAGGG - Intergenic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
984540829 4:181035109-181035131 AGGCAGGAGTGCAGGATACAGGG + Intergenic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
986510471 5:8501286-8501308 AAGGAGCAATGGGTGATATACGG - Intergenic
987059173 5:14225810-14225832 AAGCCCAAAAGGATGATACAAGG + Intronic
987769744 5:22285838-22285860 AAGTAAGAATGCCTGATACACGG - Intronic
987780494 5:22427742-22427764 AAGCAGGAATGGAGGAGAGAAGG + Intronic
988230675 5:28474516-28474538 AAGAAGGAAAGGATAATAGAAGG + Intergenic
988687405 5:33538442-33538464 AAGCAGGGAGGCATGAGACATGG - Intronic
990512935 5:56505330-56505352 AAACAGGATTGGATGACAGATGG + Intergenic
990761875 5:59138712-59138734 ATGACTGAATGGATGATACAGGG - Intronic
992253212 5:74896249-74896271 AAGCAGTAATGGATGGGGCAGGG + Intergenic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
992564278 5:77982530-77982552 AAAAAGGAATGAATGACACATGG - Intergenic
992864859 5:80947919-80947941 AAGCAGGGAGCGATGATACTGGG + Intergenic
993509029 5:88748283-88748305 AGGCAGGCATGAATGACACAAGG - Intronic
996014201 5:118514419-118514441 AAGCAGGAGTGAATGGTTCATGG - Intergenic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
996819312 5:127608505-127608527 CAGCAGGAATGCTTTATACACGG - Intergenic
997731838 5:136186883-136186905 AAGCAGGAAAGGAATATACCAGG + Intronic
997746260 5:136302562-136302584 AAGGAGGAATGGAGGGTGCAAGG - Intronic
997853172 5:137350772-137350794 AAGCAGGAAGGAATCATATAGGG + Intronic
1000431695 5:161160189-161160211 ATGGAGGAATGGATGATGGATGG - Intergenic
1001060276 5:168482436-168482458 AAGCAGGAAAGTATGTTGCAAGG + Intergenic
1001229506 5:169973906-169973928 GAGGAGGAATGGATGATGGACGG - Intronic
1001710903 5:173777231-173777253 AAGCAGGAGTGGAGGACAGAGGG + Intergenic
1004611881 6:17249438-17249460 TAGCAAGATTGCATGATACAAGG - Intergenic
1007394035 6:41567110-41567132 AAGCAGGAATGGAAGAAACCTGG + Intronic
1008055835 6:46945188-46945210 AAGCAGAAATGAATGACACTTGG - Intronic
1008115231 6:47541964-47541986 AAGTAGGATTTGGTGATACAAGG - Intronic
1008663450 6:53693315-53693337 AAAAAGGAATGTATGATAAAAGG + Intergenic
1012071163 6:94618629-94618651 AAGAAGGAACAGGTGATACATGG + Intergenic
1014219708 6:118787666-118787688 AATGAGGAATGGCTGATACCAGG - Intergenic
1014709838 6:124793992-124794014 AAGAAGAAATGGATGAGGCAGGG + Intronic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1015796075 6:137012622-137012644 AAGCATGAATGAATGATCCATGG + Intronic
1016302709 6:142650129-142650151 GAGCAGGACTGGAGGTTACATGG - Intergenic
1017160619 6:151362325-151362347 AATGAGGAATGGCTGAGACAGGG - Intergenic
1018432620 6:163734793-163734815 AAGTTGGAAGGGATGATAAAAGG - Intergenic
1021314057 7:19124306-19124328 AAGCATGAATGGAGGATGAATGG + Intergenic
1021393468 7:20121836-20121858 AAGGAGGAATGGAGGATGGAAGG - Intergenic
1021675605 7:23077617-23077639 AGGCAGGAATGGCTGCAACAGGG + Intergenic
1021873915 7:25030943-25030965 AAGCAGGAATGGATATTAAATGG - Intergenic
1022525423 7:31034028-31034050 AAGCTGGAATGGCAGATCCAAGG - Intergenic
1024347255 7:48325746-48325768 ATGCAGCAATGGCGGATACAGGG + Intronic
1025001598 7:55319981-55320003 AAGCAGCAATGCATGATAAGTGG + Intergenic
1025831212 7:65052246-65052268 AAACAGGGATAGATGATATAAGG - Intergenic
1025841802 7:65156799-65156821 CACCAGGAAAGGATTATACATGG - Intergenic
1025881246 7:65539177-65539199 CACCAGGAAAGGATTATACATGG + Intergenic
1025892193 7:65663438-65663460 CACCAGGAAAGGATTATACATGG - Intergenic
1025918361 7:65886126-65886148 AAACAGGGATAGATGATATAAGG - Intronic
1026478150 7:70754794-70754816 ACGGATGAATGGATGATGCATGG + Intronic
1027403474 7:77833380-77833402 AAGCAGCAGAGAATGATACAAGG + Intronic
1027603999 7:80276635-80276657 AAGCAGTGATGCATGCTACATGG + Intergenic
1028411476 7:90534884-90534906 AAGAAGGAATGTATGAAAAAAGG + Intronic
1029028681 7:97445800-97445822 AAGCAGGTGTGGATGCTACTTGG + Intergenic
1030186872 7:106771369-106771391 ATGCAGGAATGGAGGTTACTTGG + Intergenic
1030678892 7:112413476-112413498 AAGCAGGAAGGGATGAGAGTGGG - Intergenic
1031441622 7:121801485-121801507 AATCAGAAAGGGATGATTCATGG - Intergenic
1031908282 7:127485988-127486010 AAACAGGAATTAATGATCCAGGG + Intergenic
1033368672 7:140690133-140690155 TAGCAGGAATGGGTCAGACAAGG + Intronic
1034024146 7:147680003-147680025 AAGAAGGAATGGATGAAATTTGG - Intronic
1034986465 7:155518603-155518625 AAGCAGAGAAGGATGATAAATGG + Intronic
1035130117 7:156643681-156643703 CAGCAGGAATGCCTGCTACAGGG - Intronic
1036229201 8:6985205-6985227 AACTAAGAATGGATGAGACAGGG - Intergenic
1036231653 8:7004309-7004331 AACTAAGAATGGATGAGACAGGG - Intronic
1036579677 8:10062181-10062203 AAGGAGGAACGGATGATTGATGG - Intronic
1037924386 8:22833034-22833056 TAGAAGGAATGGGTGAGACAGGG - Intronic
1040733391 8:50476792-50476814 AAAGAGAAATGGATGATTCAAGG + Intronic
1043152802 8:76739644-76739666 AAGCAGGGAGGGATAATAAAAGG + Intronic
1043718042 8:83509580-83509602 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1044235205 8:89822627-89822649 ATGCATGAATGGATACTACAAGG + Intergenic
1044554075 8:93543175-93543197 AGGCATGAATAAATGATACAGGG + Intergenic
1044595992 8:93959108-93959130 AAGAAGGTATGGATGATTTAGGG - Intergenic
1044682385 8:94795028-94795050 AAAAATGAATGAATGATACATGG - Intergenic
1044921841 8:97176355-97176377 AAGGAGGAATGGAGGATGGAAGG - Intergenic
1045197376 8:99945129-99945151 AAGGAGGAATGGAGGATGCAAGG - Intergenic
1047362956 8:124185549-124185571 GAGCAGGGATGGAGGAAACAGGG + Intergenic
1047636016 8:126763416-126763438 AAGAATGAATGGATGATATTGGG - Intergenic
1047911254 8:129532121-129532143 AAGAGGGAAGGGATCATACATGG + Intergenic
1048549021 8:135416422-135416444 AATTAGGCATGGATGACACATGG + Intergenic
1049867508 8:144948374-144948396 CAGCAGAAATGGAGGAGACATGG + Intronic
1051110824 9:13633510-13633532 AGGCAGTAATGGATGCTGCAAGG + Intergenic
1051167282 9:14277615-14277637 GAACAGGAATGGATGACAAAGGG - Intronic
1051512150 9:17889985-17890007 AAGGAGTCATGGAAGATACAAGG - Intergenic
1052558362 9:30049903-30049925 ATGAAGGAATGTATGACACAAGG - Intergenic
1052774755 9:32722232-32722254 AACTAGGAATGGAGGATGCAGGG + Intergenic
1053833481 9:42109452-42109474 AAGAATGCATGGATAATACATGG + Intronic
1054597069 9:67077962-67077984 AAGAATGCATGGATAATACATGG - Intergenic
1054984162 9:71242739-71242761 AGGCAGTCATGGATGATAAAAGG - Intronic
1055732235 9:79289983-79290005 AAGTGGGAATGGATGAAGCAGGG + Intergenic
1057611736 9:96550263-96550285 TAGCAGAAAGGGATGATACTGGG + Intronic
1058668955 9:107344463-107344485 AAGCAGCAATGGCAGATACCTGG - Intergenic
1058758864 9:108110136-108110158 TAGCAGGAAGGGAGGAGACAAGG + Intergenic
1059072104 9:111148691-111148713 AAACTGGAATGGATGCTAAACGG + Intergenic
1059343494 9:113612902-113612924 AGGCAGGAAGGGCTGCTACAGGG - Intergenic
1059516663 9:114902320-114902342 AAGCAGGAATATATTATGCAGGG + Intronic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1061683609 9:132257456-132257478 AAACAGGAATGGTGGGTACAGGG + Intergenic
1062172272 9:135141585-135141607 ATGGATGAATGGATGATAGATGG + Intergenic
1185566249 X:1097605-1097627 AAGCAGGAATGGCTGAAGAATGG - Intergenic
1185960837 X:4544920-4544942 AAGGAGGAATGGAGGATGGAAGG + Intergenic
1186744752 X:12556156-12556178 CAGCAGGAGGGGATTATACAGGG - Intronic
1187979463 X:24739910-24739932 TAGCAGGAATGAATGAGAGATGG - Intronic
1192273505 X:69607030-69607052 ATCCAGGAATGGACGCTACAGGG - Intergenic
1193681188 X:84520245-84520267 GGACAGGAATGGATGTTACAGGG + Intergenic
1197622742 X:128769205-128769227 AAGAAAGAATGGAGGATACATGG - Intergenic
1198685986 X:139228642-139228664 GAGAAGGAATAGATTATACAGGG + Intergenic
1199052369 X:143252015-143252037 AAGAAGGAATGAATGGAACAAGG + Intergenic