ID: 1146272395

View in Genome Browser
Species Human (GRCh38)
Location 17:31492900-31492922
Sequence AGTAACCACCAAGGTTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146272395_1146272400 17 Left 1146272395 17:31492900-31492922 CCCAGACAACCTTGGTGGTTACT 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1146272400 17:31492940-31492962 GACCTGGAAAGGAGATGAGACGG 0: 1
1: 0
2: 7
3: 79
4: 637
1146272395_1146272399 6 Left 1146272395 17:31492900-31492922 CCCAGACAACCTTGGTGGTTACT 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1146272399 17:31492929-31492951 CTTTTTCGCATGACCTGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 82
1146272395_1146272401 18 Left 1146272395 17:31492900-31492922 CCCAGACAACCTTGGTGGTTACT 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1146272401 17:31492941-31492963 ACCTGGAAAGGAGATGAGACGGG 0: 1
1: 0
2: 5
3: 30
4: 380
1146272395_1146272404 22 Left 1146272395 17:31492900-31492922 CCCAGACAACCTTGGTGGTTACT 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1146272404 17:31492945-31492967 GGAAAGGAGATGAGACGGGGAGG 0: 1
1: 0
2: 5
3: 82
4: 834
1146272395_1146272403 19 Left 1146272395 17:31492900-31492922 CCCAGACAACCTTGGTGGTTACT 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1146272403 17:31492942-31492964 CCTGGAAAGGAGATGAGACGGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1146272395_1146272398 1 Left 1146272395 17:31492900-31492922 CCCAGACAACCTTGGTGGTTACT 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1146272398 17:31492924-31492946 CTTCACTTTTTCGCATGACCTGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146272395 Original CRISPR AGTAACCACCAAGGTTGTCT GGG (reversed) Intronic