ID: 1146272928

View in Genome Browser
Species Human (GRCh38)
Location 17:31496400-31496422
Sequence CTCTTAACCCAGATGGAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146272928_1146272941 18 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272941 17:31496441-31496463 GTGGGTCACTGGCCTTCCCAAGG 0: 1
1: 0
2: 1
3: 29
4: 210
1146272928_1146272938 -1 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272938 17:31496422-31496444 GGGAAAATGAGGGCTGGGAGTGG 0: 1
1: 1
2: 8
3: 124
4: 1096
1146272928_1146272943 27 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272943 17:31496450-31496472 TGGCCTTCCCAAGGGAGCAGAGG 0: 1
1: 0
2: 5
3: 27
4: 241
1146272928_1146272936 -7 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272936 17:31496416-31496438 TTAAGAGGGAAAATGAGGGCTGG 0: 1
1: 0
2: 4
3: 69
4: 622
1146272928_1146272944 28 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272944 17:31496451-31496473 GGCCTTCCCAAGGGAGCAGAGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1146272928_1146272939 0 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272939 17:31496423-31496445 GGAAAATGAGGGCTGGGAGTGGG 0: 1
1: 0
2: 7
3: 70
4: 610
1146272928_1146272940 7 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272940 17:31496430-31496452 GAGGGCTGGGAGTGGGTCACTGG 0: 1
1: 0
2: 7
3: 53
4: 468
1146272928_1146272937 -6 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272937 17:31496417-31496439 TAAGAGGGAAAATGAGGGCTGGG 0: 1
1: 0
2: 1
3: 67
4: 588
1146272928_1146272942 19 Left 1146272928 17:31496400-31496422 CCCCGTTCCATCTGGGTTAAGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1146272942 17:31496442-31496464 TGGGTCACTGGCCTTCCCAAGGG 0: 1
1: 0
2: 0
3: 30
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146272928 Original CRISPR CTCTTAACCCAGATGGAACG GGG (reversed) Intronic
906332562 1:44899330-44899352 CTCTTTAATCAGATGGAAAGGGG - Intronic
907304771 1:53507387-53507409 CTCTGAAGCCAGATGGACCTGGG - Intronic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
913492905 1:119398330-119398352 AACTTAACACAAATGGAACGAGG - Intergenic
921280318 1:213560286-213560308 CTCTAAACCCAGATTTAAAGGGG - Intergenic
921322872 1:213960220-213960242 ATATTAACCAAGAAGGAACGTGG + Intergenic
923734107 1:236585081-236585103 CTCTTATCGCAAATGGAAAGTGG + Exonic
1074078832 10:110151980-110152002 CCCCTAACCCAGAGGGAAAGAGG + Intergenic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1088984714 11:114895449-114895471 GTCTCAACCCAAATGGAAGGTGG - Intergenic
1093505076 12:19855676-19855698 CTTTTTACCCAGAAGGAAAGTGG - Intergenic
1104320988 12:127750570-127750592 ATCATAACACAGATGGGACGTGG - Intergenic
1109118226 13:58418194-58418216 CTCTGAACACTGATGAAACGAGG + Intergenic
1116629762 14:47315206-47315228 CTCTTAATCCAGATGGATAAAGG + Intronic
1117041691 14:51774394-51774416 CTCATGACCCAGATGGCAGGGGG - Intergenic
1126919332 15:53503373-53503395 CTCTTCACAGAGATGGAACATGG - Intergenic
1127361155 15:58246222-58246244 CTCTCAACCCAGAAGGCAGGAGG + Intronic
1132069548 15:98763682-98763704 CACTTAACCCAGTTGTAACAAGG - Intronic
1139323541 16:66134398-66134420 CTCTTAACCCAGATGAAGGCGGG + Intergenic
1146272928 17:31496400-31496422 CTCTTAACCCAGATGGAACGGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147347609 17:39812754-39812776 CTCTTAATCCAGCTGGAAGGAGG + Intronic
1161041573 19:2113329-2113351 CTCTTACCGTGGATGGAACGGGG + Exonic
1164145399 19:22509785-22509807 CACTTAGCTCAGATGGAACCTGG - Intronic
1165440255 19:35822219-35822241 CTCTTAAACCAGTTTGAATGAGG - Intergenic
926834315 2:17000661-17000683 CTCTTACTCCAGATGAAAGGAGG - Intergenic
1173337409 20:42124049-42124071 CTCTTTACTCAGATGCAGCGTGG - Intronic
1179274713 21:39881741-39881763 CTCTGCACCCAGATGGACTGAGG + Intronic
1181949879 22:26546248-26546270 ATCTAAACCCAGATGGAAAAGGG + Intronic
950785261 3:15428530-15428552 CTCTTTACCCACAAGGAACTTGG - Intronic
953363468 3:42321802-42321824 CTCTGAAGCCAGATGGAACCAGG + Intergenic
957506062 3:81122523-81122545 CTCTTAACCCACATGGAAACAGG - Intergenic
960009012 3:112812902-112812924 CTCTTAACCCAGTTGAAGAGAGG - Intronic
965668414 3:171120732-171120754 GTCTCAACCCAGAAGGAACCTGG - Intronic
967099417 3:186203943-186203965 CTCTTAAACTAGAGGGAAAGAGG - Intronic
972637544 4:40897653-40897675 CACTTAAGCCACATGGAATGGGG - Intronic
974116662 4:57587457-57587479 CTCTTCACCCAGATGGGCTGTGG - Intergenic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
987906194 5:24080440-24080462 CTCTTAAGCAAGAGGGAACCAGG - Intronic
993409835 5:87559676-87559698 ATCAAAACCCAGATGGAATGAGG - Intergenic
1006102948 6:31697462-31697484 CTCTGAAGCCAGATGGCAAGGGG - Intronic
1008122295 6:47632433-47632455 GTCCTACCCCAGAAGGAACGTGG + Intergenic
1011856235 6:91694935-91694957 CTCTGATCCCAGCTGGAACAAGG - Intergenic
1020413411 7:7917895-7917917 GTCTGAATCCAGATGGAAGGAGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1035243755 7:157549094-157549116 CTCTCAGCCCAGAGGGAACGTGG - Intronic
1045713575 8:105015142-105015164 CTCTTAAACCAGAGGGAGCTTGG - Intronic
1050989731 9:12134749-12134771 CTCTTATCCAAGAAGGAACATGG - Intergenic
1051897267 9:22000577-22000599 CTCAGAACTCAGATGGAATGAGG + Intronic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1058941505 9:109816871-109816893 CTCTTAAGCCAGATGGCATTAGG - Intronic
1059920650 9:119156732-119156754 CTCTTAACCTAGATTGGACCGGG - Intronic
1062097744 9:134711667-134711689 CTCTTAACCCAGAAAGATCCAGG - Intronic
1194897576 X:99464059-99464081 CAGTTAACCCAGAAGGAATGTGG - Intergenic
1198221836 X:134609725-134609747 CTCTTCACCCAGATGCACCAAGG - Intronic