ID: 1146275048

View in Genome Browser
Species Human (GRCh38)
Location 17:31511257-31511279
Sequence CGGCAAAAGGAGGCGCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146275048_1146275059 25 Left 1146275048 17:31511257-31511279 CCACCCCGCGCCTCCTTTTGCCG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1146275059 17:31511305-31511327 GGCATTGTCCTAGTTCCCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 187
1146275048_1146275055 4 Left 1146275048 17:31511257-31511279 CCACCCCGCGCCTCCTTTTGCCG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1146275055 17:31511284-31511306 TTCCGCGCCCTCATGACACAAGG 0: 1
1: 0
2: 0
3: 1
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146275048 Original CRISPR CGGCAAAAGGAGGCGCGGGG TGG (reversed) Intronic
900227657 1:1540493-1540515 CGGGGGGAGGAGGCGCGGGGGGG + Intergenic
900323345 1:2095704-2095726 AGGGAAAAGGAGGGGAGGGGAGG - Intronic
901860383 1:12070570-12070592 CAGCAATAGGAGGCGCAGGCAGG - Intronic
902811865 1:18892545-18892567 AGGTAGAAGGAGGCGGGGGGGGG + Intronic
903166447 1:21523753-21523775 GGGCAGAAGGAGGCTCAGGGAGG + Intronic
904725076 1:32540559-32540581 CGGGAACAGGAGGCCCTGGGCGG - Intronic
905690662 1:39940504-39940526 GGGCAAAAGGAGGCCCGAAGAGG + Intergenic
905790293 1:40785825-40785847 CGGCACAGGGAGGGGCAGGGGGG + Intronic
907319046 1:53591306-53591328 AGGCAAGAGGAGGCCAGGGGAGG + Intronic
907525175 1:55049805-55049827 CGGCAGATGGAAGCTCGGGGAGG - Intronic
908535150 1:65069372-65069394 TGGTAAAACGAGGGGCGGGGCGG - Intergenic
908566752 1:65364686-65364708 TGGTAAAAGGAGGTGCAGGGAGG + Exonic
909622365 1:77683027-77683049 GGGCGAAAGGGGGGGCGGGGAGG - Intronic
909827286 1:80142358-80142380 GGGCAAAAGAAAGAGCGGGGAGG + Intergenic
912486872 1:110035589-110035611 CTGCAAAAGGAGGCAGTGGGAGG - Intronic
918758363 1:188367831-188367853 CAGCAAAAGGAGGGGCAGGAAGG - Intergenic
919743096 1:200992271-200992293 CGGCGACAGGAGGTGAGGGGTGG - Exonic
920914687 1:210250801-210250823 CGGCTAAAGGAGGCGGGGGCAGG - Intergenic
920942959 1:210501336-210501358 CGGCAAAAGGGAGAACGGGGAGG - Intronic
923323157 1:232856575-232856597 CTGCAAAAGGAGCAGTGGGGAGG - Intergenic
923659271 1:235944551-235944573 GAGCAAAAGGAGGCCCGGAGAGG + Intergenic
924688889 1:246325200-246325222 AGGGAAAAGGAGTCGGGGGGCGG + Intronic
1063497890 10:6527009-6527031 AGGGAAAAGGAGGAGCAGGGCGG + Intronic
1069821647 10:71232205-71232227 CAGGAAAAGGAGGTGCTGGGGGG - Intronic
1076726022 10:132413720-132413742 CATCACAAGGAGGCGAGGGGCGG - Intronic
1077437572 11:2550185-2550207 CGGCAAAGAGAGGCGGGGGAGGG - Intronic
1081327456 11:41762850-41762872 AGACAAAAGGAGGAGTGGGGAGG + Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097090574 12:56501287-56501309 CGGGAAAGGGCGGGGCGGGGGGG - Intergenic
1098320624 12:69239856-69239878 CGGTAGAACGAGGGGCGGGGGGG - Intronic
1101427351 12:104598996-104599018 CAGCTAAGGGAGGCGCGGAGGGG + Intronic
1102108935 12:110349404-110349426 AGGCCAAGGGAGGCACGGGGTGG - Intronic
1102934085 12:116882230-116882252 CGGCGAGAGGAGGGGCGCGGGGG + Intergenic
1103294847 12:119877280-119877302 CGGCGGCGGGAGGCGCGGGGCGG - Exonic
1103514813 12:121500619-121500641 CGGCAAAGGGAGGCGCAGCTTGG + Intronic
1103899255 12:124295062-124295084 CTAGAAAAGGAGGCGCGGGCCGG + Intronic
1105437709 13:20391553-20391575 TGGGGAAAGGAGGCGAGGGGTGG + Intergenic
1106400450 13:29424829-29424851 CAGCAAAAGGAGAGGAGGGGTGG + Intronic
1106510466 13:30408501-30408523 CACCAAATGGAGGCGCGAGGAGG + Intergenic
1110677507 13:78266866-78266888 TGGCAAAAGGAGGTGCAGGAAGG + Intergenic
1112294750 13:98176984-98177006 CGGCGACAGGAGGGGCGAGGAGG - Exonic
1113600191 13:111563187-111563209 CGGAAAGAGGAGGTGAGGGGAGG - Intergenic
1113600215 13:111563262-111563284 CGGAAAAAGGAGGTGAGGGGAGG - Intergenic
1113600239 13:111563337-111563359 CGGAAAAAGGAGGTGAGGGGAGG - Intergenic
1113669809 13:112168528-112168550 AGGCAAATGGAGGCTCTGGGAGG + Intergenic
1114525495 14:23365212-23365234 AGGCAGGAGGAGGAGCGGGGCGG + Exonic
1118888590 14:69887931-69887953 CTGCAAAAGGCGGTGAGGGGAGG - Intronic
1119972225 14:78984045-78984067 TGGCTATAGGAGGCGGGGGGAGG + Intronic
1122415739 14:101548699-101548721 AGGGAAGAGGAGGCGGGGGGAGG + Intergenic
1125676606 15:41505458-41505480 CAGCAGAATGAGGCGAGGGGTGG + Exonic
1127917417 15:63466753-63466775 CTGCAAGAGAAGGGGCGGGGGGG - Intergenic
1128243759 15:66119016-66119038 AGGCAAAAGGAGGGGAGGGGAGG - Intronic
1131162141 15:90113279-90113301 CTGCAAAAGGAAGGCCGGGGCGG - Intergenic
1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG + Intronic
1132588113 16:715028-715050 CGCCAATAGCAGGCGCGGGGCGG - Intronic
1133212742 16:4272322-4272344 GGGAAAGAGGAAGCGCGGGGGGG + Intronic
1133359999 16:5166662-5166684 CTGCAGAAGGAGGCCCAGGGAGG + Intergenic
1134134222 16:11668767-11668789 CGGACAAAGGAGGCGGCGGGGGG + Intronic
1134290705 16:12901537-12901559 CGGGCAGAGGAGGCGCGGGTGGG - Intergenic
1135731099 16:24895583-24895605 AGGGAAAAGGAGGGGAGGGGAGG + Intronic
1136079202 16:27840506-27840528 CGCCAAAAGGAGGAGTGGGCAGG + Intronic
1136375713 16:29863952-29863974 CGGCAAAAGGAGAGACGTGGAGG - Intergenic
1137707930 16:50548328-50548350 CGGCCAATGGGCGCGCGGGGAGG + Exonic
1139545692 16:67648563-67648585 CGACAGAAGCAGGAGCGGGGAGG - Intronic
1140272567 16:73479920-73479942 GGGCAAATGGAGGCATGGGGAGG + Intergenic
1141747402 16:85934952-85934974 CGGGAAAACGAGGCCTGGGGTGG - Intergenic
1142378964 16:89721252-89721274 TGGGAGACGGAGGCGCGGGGCGG - Intronic
1142428341 16:90012414-90012436 GGACAGAAGGAGGGGCGGGGAGG - Intronic
1143935088 17:10475599-10475621 AGGCAAAGGGAGGGGAGGGGAGG - Intergenic
1144057966 17:11558605-11558627 GGGGAGAAGGAGGCGCGGGACGG - Exonic
1144098769 17:11925430-11925452 CTGGAAAAGGAGGCCCTGGGAGG - Intronic
1145327246 17:21842581-21842603 CGGCAAAAGCCGTGGCGGGGGGG - Intergenic
1146275048 17:31511257-31511279 CGGCAAAAGGAGGCGCGGGGTGG - Intronic
1147393114 17:40122179-40122201 GGGGAAATGGAGGCTCGGGGCGG + Intergenic
1147752563 17:42745081-42745103 CGCCGACAGGAGGCGCGGGGCGG - Intergenic
1152604192 17:81280874-81280896 CGGCACAAGGCGGCACAGGGCGG - Intronic
1159379868 18:67643382-67643404 AGGGAAAAGGAGGGGAGGGGAGG - Intergenic
1160503028 18:79411531-79411553 AGGCGAGGGGAGGCGCGGGGCGG + Intronic
1160691266 19:461502-461524 GGGGAAACTGAGGCGCGGGGAGG + Intergenic
1161733815 19:5978304-5978326 CGGGAAAAGGAGGCGGGAGATGG - Intergenic
1161803032 19:6426254-6426276 TGGCAAAAGCAGGCTGGGGGTGG - Exonic
1162962638 19:14136908-14136930 CGGAAAAGCGAGGCGAGGGGCGG - Exonic
1164156745 19:22601877-22601899 GGGGAGAAGGAGGGGCGGGGGGG + Intergenic
1164578110 19:29417873-29417895 CGGCTGGAGGAGGCGAGGGGAGG - Intergenic
1166719083 19:44987289-44987311 GGGCAGAAGGAGACGCGGAGCGG - Exonic
1166743690 19:45129788-45129810 AGGGAAAAGGAGGAGCGGGGAGG + Intronic
1167295128 19:48645348-48645370 CTGAAGAAGGAGGCGCCGGGAGG + Intronic
1167343991 19:48933834-48933856 GGGGAAGAGGAGGCGGGGGGCGG + Intronic
1167389261 19:49183051-49183073 CAGCAAAAGGAGGGGTGGTGAGG - Intronic
926217111 2:10912378-10912400 CGGCTGCAGGGGGCGCGGGGCGG + Exonic
928964930 2:36966666-36966688 CGGGAAATGTAGTCGCGGGGCGG + Intergenic
931778132 2:65557250-65557272 AGGGAAAAGGAGGGGAGGGGAGG - Intergenic
936447510 2:112607368-112607390 AGGCAAAGGGAGGGGAGGGGAGG - Intergenic
937972138 2:127559106-127559128 CAGCAGGAGGAGGAGCGGGGAGG - Intronic
942842066 2:180374129-180374151 CGGCAAAAGGTAAAGCGGGGGGG - Intergenic
945189038 2:207166958-207166980 GGTCAGAAGGAGGCGCGGGAGGG - Intronic
945765321 2:213969333-213969355 TGGCAATAGGAGGTGCCGGGTGG + Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948721567 2:239904096-239904118 GGGCAAAAGGAGGAGGGGTGGGG + Intronic
1169664597 20:8019815-8019837 CGGCAAGTGGAGGCGGGAGGGGG - Exonic
1171437782 20:25136505-25136527 GGGCAAAAGGAGGGAGGGGGAGG - Intergenic
1172444954 20:34988027-34988049 GGGGAAAGGGAGGCCCGGGGAGG - Intronic
1173640380 20:44597699-44597721 CCGCAGCAGGAGGCCCGGGGAGG - Intronic
1174200758 20:48804882-48804904 CCGCAAGAGGAGTGGCGGGGAGG + Intronic
1174358864 20:50015555-50015577 CTGGAAACGGAGGCGGGGGGAGG - Intergenic
1174360844 20:50028063-50028085 CGGGAAAAGGGGGAGCGGGGCGG + Intergenic
1175226735 20:57448985-57449007 CGGGAAATGGAGGCTCGGGTAGG + Intergenic
1176242228 20:64080368-64080390 CGGCTCACGGAGGCGAGGGGTGG - Intronic
1177825017 21:26073256-26073278 TTGCAAAAGGTGGCGCGGGGAGG + Intronic
1178153264 21:29820837-29820859 CGGCAAACTGAGGCACAGGGAGG + Intronic
1179242209 21:39602285-39602307 CCACAGAAGGAGGCGCGGGCAGG - Intronic
1183490002 22:38111092-38111114 CGGCAAGTGGAGGAGCTGGGCGG - Intergenic
1183546167 22:38455682-38455704 GGGCAGAGGGAGGCGGGGGGAGG - Intergenic
1184660133 22:45961863-45961885 CGGCAAACTGAGGCTCAGGGAGG - Intronic
1184782860 22:46657777-46657799 CAGCACATGGAGGCGCTGGGTGG + Intronic
1185123824 22:48992693-48992715 TGGGAAAGGGAGGGGCGGGGAGG + Intergenic
954121786 3:48504056-48504078 CGGCAACAGGATCCGCGGCGCGG + Exonic
954613732 3:51959195-51959217 CTGCACAAGGAGGCAGGGGGAGG - Intronic
968133630 3:196207464-196207486 CGGCACCAGGAGGCCCGCGGCGG + Exonic
968946824 4:3669237-3669259 CGGCACAAGGGGGCCTGGGGTGG + Intergenic
969558631 4:7931095-7931117 GGGCAACAGGAGGAGCGGGGAGG + Intronic
970235956 4:13958166-13958188 AAGAAAAAGGAGGAGCGGGGAGG - Intergenic
972655257 4:41057860-41057882 CTGCTAAAGGAAGAGCGGGGAGG - Intronic
972972039 4:44588733-44588755 CTACAAAAGGTGGCGGGGGGAGG + Intergenic
978540451 4:109811048-109811070 CGGCAAAGGGAGGTGGGGTGGGG + Intergenic
982288790 4:153759922-153759944 CCGCAGAAGGAGGCGCCGCGGGG + Exonic
984048170 4:174829268-174829290 CGGCAAAGGGAAGCGGGGGTGGG + Exonic
984462930 4:180058833-180058855 CCGGAGAGGGAGGCGCGGGGAGG + Intergenic
986688404 5:10294001-10294023 TGGGCAAAGGAGGCGAGGGGTGG + Intronic
987090021 5:14502120-14502142 CTGTGAAAGGAGGCGTGGGGAGG + Intronic
997379079 5:133422335-133422357 TGGCAAAAGGAGAAGCAGGGAGG + Intronic
998946259 5:147342516-147342538 AGGCAAAAGGAGACAGGGGGTGG + Intronic
999739809 5:154541755-154541777 GGGCACCAGGAGGCGAGGGGAGG + Intergenic
1002033542 5:176448251-176448273 CGGCCAGAGGTGGCGGGGGGCGG + Intronic
1003080099 6:3014837-3014859 AGGAAAAAGGAGGCACAGGGAGG + Intronic
1003844926 6:10163286-10163308 ATCCAAAAGGAGGGGCGGGGAGG - Intronic
1005489324 6:26332392-26332414 GGGGAAAAGGTGGGGCGGGGTGG - Intergenic
1006078104 6:31547397-31547419 GAGGAAAAGGAGGCGAGGGGAGG - Intronic
1009808720 6:68635029-68635051 AGGCGAAGGGAGCCGCGGGGTGG - Intergenic
1014719754 6:124901912-124901934 TGGCAAAAGCAGGAGCAGGGTGG + Intergenic
1017764116 6:157593104-157593126 CTGCAATGGGAGGCGCGAGGGGG - Exonic
1018183309 6:161243300-161243322 CGGCAGAAGCAGGCGTGAGGTGG + Intronic
1019437016 7:1027755-1027777 CGGCACAGGGAGGGGCGAGGCGG + Intronic
1022098064 7:27153031-27153053 CTGCAGTAGGTGGCGCGGGGAGG - Intergenic
1025812363 7:64883281-64883303 CCGGAAAAGGAGGCGCTCGGAGG - Intronic
1031100997 7:117479752-117479774 CGGGAAAGGGAGGTGCGGGGCGG + Intronic
1032240476 7:130155136-130155158 AGGCAACAGGAGGTGCAGGGAGG + Intergenic
1033319403 7:140326274-140326296 CGGAAATAGGAGGCCAGGGGAGG + Intronic
1035215823 7:157365968-157365990 CAACAAGAGTAGGCGCGGGGGGG - Intronic
1035327475 7:158074335-158074357 AGGCAACAGAAGGCGCAGGGAGG + Intronic
1036569898 8:9971196-9971218 AGGCCAAAGGAGGGGGGGGGGGG - Intergenic
1038462592 8:27729447-27729469 GGGCAAATGGAGGCCCAGGGAGG + Intergenic
1038708501 8:29919772-29919794 GGGCAAAAGGAGGGGCAGGTAGG - Intergenic
1041673601 8:60516815-60516837 CGGGCAAGGCAGGCGCGGGGCGG + Intergenic
1046572877 8:115988766-115988788 TGGCAAAAGGAGGCTGGGCGCGG - Intergenic
1048132546 8:131713755-131713777 AGGGAAAAGGAGGGGAGGGGAGG + Intergenic
1048890498 8:138942481-138942503 CAGCAAAGGGAGGCTCAGGGAGG - Intergenic
1049020118 8:139950888-139950910 CGGCAAGAGGAGGCGCGGCAGGG + Intronic
1049377929 8:142297908-142297930 CAGCAACAGCAGGCGCGGGACGG - Intronic
1056134771 9:83621227-83621249 GGGCAAGAGGAGGGGAGGGGAGG + Intergenic
1058876642 9:109250342-109250364 TGGCAAAACGTGGCACGGGGTGG - Intronic
1060437663 9:123608470-123608492 GAGCAAAATGAGGCGTGGGGAGG - Intronic
1060811698 9:126614134-126614156 CTGCAGACGGAGCCGCGGGGAGG - Intergenic
1061403168 9:130379305-130379327 CGGGAGGAGGAGGCCCGGGGCGG + Intronic
1061849982 9:133408902-133408924 TTGCAAAAGGTGGCGGGGGGAGG - Intronic
1061870377 9:133517168-133517190 GGGCAGAAGGAGGCGAGAGGCGG + Intronic
1062522460 9:136963964-136963986 CGGCAAGGCGAGGCACGGGGTGG + Intergenic
1190581330 X:51894817-51894839 GGGCAAAATGAGGGGTGGGGCGG - Intronic
1197590000 X:128397040-128397062 GGGCAAGAGGAGGGGAGGGGAGG - Intergenic
1197732557 X:129823699-129823721 CTGCAATGGGAGGCCCGGGGAGG + Exonic
1200128789 X:153830308-153830330 CGGCGAGAGGAGGCGGAGGGCGG + Exonic
1200228275 X:154431385-154431407 CGCCAAAAGCAGGTGGGGGGAGG + Intronic