ID: 1146275861

View in Genome Browser
Species Human (GRCh38)
Location 17:31515201-31515223
Sequence TTCTACTGGGATGCAGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146275856_1146275861 13 Left 1146275856 17:31515165-31515187 CCTAATGGCTGCTCAGTGATGCT 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1146275861 17:31515201-31515223 TTCTACTGGGATGCAGCTTCAGG 0: 1
1: 0
2: 1
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146275861 Original CRISPR TTCTACTGGGATGCAGCTTC AGG Intronic
901040586 1:6360682-6360704 TTCCATTTGGCTGCAGCTTCTGG - Intronic
904917624 1:33981834-33981856 TTCTGCTGGGATGGGGCTGCAGG + Intronic
906669429 1:47643834-47643856 TCCTCCTGGGAAGCAGCCTCAGG - Intergenic
909490021 1:76215836-76215858 GTCCACTGGGTGGCAGCTTCAGG + Intronic
914898476 1:151697817-151697839 TTCTGCTGGGATGAAGCTGGGGG - Exonic
915336398 1:155145069-155145091 TTCTACTGTGTTGCTGCTACAGG + Intergenic
917544697 1:175951636-175951658 TTCTACTGAGAGGCAATTTCTGG + Intronic
918751303 1:188272814-188272836 TGCTGCTGTGATGAAGCTTCTGG - Intergenic
919613396 1:199774998-199775020 TTCTCCTGGGAAGCTGCTTTAGG - Intergenic
922725155 1:227919347-227919369 TGGTACGGGGATGCAGCTGCAGG + Exonic
924693646 1:246377295-246377317 ATCTACTGCAATGTAGCTTCTGG + Intronic
1062929623 10:1344367-1344389 TTCTCCTGCCATGCAGCTTTGGG - Intronic
1063345479 10:5307976-5307998 TTCTTTTGGGATGCAGCCTCAGG - Intergenic
1064849882 10:19698713-19698735 CTCTACTCTGATGCAGCTCCGGG - Intronic
1065783515 10:29192205-29192227 TTCTACTGGAAGGCAGCTTTGGG + Intergenic
1072608985 10:97004303-97004325 GTCTCCTGGGAAGCAGCTACTGG - Intronic
1079012690 11:16842373-16842395 TTCGACTGGTGTGCAGCTTCAGG - Intronic
1081269460 11:41065687-41065709 TCCCTCTGGGATGAAGCTTCCGG + Intronic
1086261448 11:84945830-84945852 ATCTACTGGGATCCAGGATCTGG + Intronic
1087304209 11:96470036-96470058 TTCTGCTGTCATGCATCTTCTGG + Intronic
1089347919 11:117803216-117803238 TTATACTGTGATACAACTTCTGG - Intronic
1093936946 12:25011562-25011584 TCCTAGTGGGATGCAGTTTAAGG + Intergenic
1098764454 12:74468877-74468899 CTCTTCTGGGATGAAGCTACCGG - Intergenic
1101873872 12:108586226-108586248 TTCCACTAGAATACAGCTTCAGG + Intergenic
1106859345 13:33888223-33888245 TTCCACTGGCATGCAAGTTCAGG + Intronic
1107176544 13:37406115-37406137 TTCCACTGTGATGCATCTCCTGG + Intergenic
1108701182 13:52945591-52945613 TTCTCCTGGTTTGCAACTTCTGG - Intergenic
1109858309 13:68162880-68162902 TTCAACAGAGATGCAGCTCCAGG - Intergenic
1112625287 13:101096993-101097015 TTCTGCTGGGATGCTGGTCCAGG - Intronic
1113840809 13:113360146-113360168 GTCTGCAGGGAAGCAGCTTCAGG - Intronic
1115306809 14:31942226-31942248 TGCTAATTGCATGCAGCTTCAGG + Intergenic
1116339773 14:43706939-43706961 TTCTATTGGGGTTCATCTTCAGG + Intergenic
1117342445 14:54803975-54803997 TTCCTCTGGAATCCAGCTTCTGG + Intergenic
1120153575 14:81065205-81065227 GTGTACTGGGGTGGAGCTTCGGG - Intronic
1121605881 14:95239425-95239447 TTCTATAAGGATTCAGCTTCTGG + Intronic
1121942758 14:98088618-98088640 TTTTACTAGAGTGCAGCTTCAGG - Intergenic
1128754397 15:70171485-70171507 TTTTACAGGAATTCAGCTTCTGG - Intergenic
1129852860 15:78804541-78804563 GCCTGCTGGGATGGAGCTTCGGG - Intronic
1130458804 15:84142433-84142455 TTCTACACAGATGCAGATTCAGG - Intergenic
1132107130 15:99071122-99071144 TGCTCCAGGGCTGCAGCTTCGGG + Intergenic
1132534706 16:472337-472359 ATCAGCTGGGCTGCAGCTTCTGG + Intronic
1134638654 16:15811616-15811638 CTCTACTGGGGAGCAGCCTCAGG + Intronic
1135408499 16:22215609-22215631 ATTTACTGGGATGCAGCATTAGG - Intronic
1138174677 16:54886003-54886025 ATCTACTGGGTTGCATTTTCAGG + Intergenic
1138348006 16:56331683-56331705 TGCTTCTGGGATGGAGCTTGGGG - Intronic
1141946704 16:87315671-87315693 CTCTCATGGGATGCAGCTTCTGG + Intronic
1142838229 17:2605554-2605576 GTCTACTGTGATTCAGCTTTGGG + Intronic
1143997185 17:11017005-11017027 TTCTACTGGGATGCTGTTTCTGG - Intergenic
1146275861 17:31515201-31515223 TTCTACTGGGATGCAGCTTCAGG + Intronic
1148326281 17:46785220-46785242 TTGTCCTGGGATCCAGGTTCTGG + Intronic
1150987661 17:70216506-70216528 TTATACTGAGATCCAGTTTCCGG + Intergenic
1153355912 18:4135014-4135036 TTCTACTGTGTTTCAGTTTCCGG - Intronic
1157486978 18:48094868-48094890 TTCTACCTGGATGCAGCTCTGGG + Intronic
1158752062 18:60273606-60273628 TTCTACTAGAATGTATCTTCTGG - Intergenic
1160668111 19:343007-343029 TCCTACAGGGATGCAGAGTCTGG - Intronic
1168198151 19:54790959-54790981 ATCTCCTGGGATGGAGCTTGGGG - Intronic
927720303 2:25378034-25378056 TGCTTCTGGCATGGAGCTTCTGG + Intronic
927838870 2:26424211-26424233 CTCTACTGGAAGGCAGCATCTGG + Intronic
929420540 2:41785539-41785561 AGCTGCTGGGATGCAGCTCCCGG - Intergenic
932046085 2:68351288-68351310 TTGTACTGTGATGCACGTTCAGG - Intergenic
933548488 2:83743738-83743760 TTCTGCTGGGCTGCAGCTACTGG + Intergenic
934150055 2:89137543-89137565 TTCTACTGGAATTCAGGATCTGG + Intergenic
934217241 2:90044485-90044507 TTCTACTGGAATTCAGGATCTGG - Intergenic
934818650 2:97352844-97352866 TTCTAGAGGGATACAGCTCCAGG - Intergenic
941563630 2:167080398-167080420 TGATACTGTGATGCACCTTCAGG + Intronic
942522341 2:176817631-176817653 TTCTCCTGGCCTGCAGCTCCAGG + Intergenic
946819207 2:223613131-223613153 TTCTTCTGGGAGTCTGCTTCTGG + Intergenic
947037690 2:225877992-225878014 TTCTATTGGAATGCATCTTAAGG - Intergenic
948406221 2:237721882-237721904 TTCTCCTGAGATGTAGCCTCAGG + Intronic
1169300421 20:4437389-4437411 CTCTACTTGGAAGCAGGTTCGGG + Intergenic
1175952084 20:62588913-62588935 CTCTCCTGGGAGGCAGCTCCAGG - Intergenic
1178691705 21:34755334-34755356 TTCTACTGGGAAATAGCTTCTGG - Intergenic
1179577095 21:42314746-42314768 TTCTAATGGGCTGCAAGTTCGGG + Intronic
1181011104 22:20041047-20041069 TTCTGCTGGCAAGAAGCTTCAGG + Intronic
1183745975 22:39691867-39691889 TCCTCCTGGGATGCTGCTTTTGG + Intergenic
1184687221 22:46102144-46102166 TTCTACTGCGGGGCAGCTTGGGG - Intronic
949567024 3:5254359-5254381 TCCCACTGAGATGCAGTTTCTGG + Intergenic
949572373 3:5305857-5305879 TGCTACTGTGATTCTGCTTCTGG + Intergenic
952419335 3:33117399-33117421 TGCTACTGGTGTGCAGCCTCAGG + Intronic
954388724 3:50258041-50258063 CTCCGCTGGCATGCAGCTTCCGG - Intronic
959803249 3:110521085-110521107 TTCTATTGGATTGCAGTTTCTGG + Intergenic
960918332 3:122720396-122720418 TTCTGCTAGAATGCAGTTTCTGG + Intronic
963613893 3:147509744-147509766 TTCTTTTGGGATTCATCTTCTGG + Intronic
967042781 3:185708955-185708977 TTCTGCTGTGATGAAGATTCCGG + Intronic
967289627 3:187906305-187906327 TTCTACAGTGATGGAGCTTGGGG - Intergenic
969473137 4:7401583-7401605 TCCTGCTGTGATGCAGCCTCAGG + Intronic
971735188 4:30439942-30439964 TTAAGCTGGGATGCAGCTTAGGG - Intergenic
971746364 4:30586604-30586626 CCCTTCTGGGATGAAGCTTCCGG - Intergenic
975998334 4:80341451-80341473 CTCCACTGGGATGGAGCTCCCGG + Intronic
980000457 4:127481558-127481580 TTCTACTGGGATAAACCTTGTGG - Intergenic
981018926 4:140004773-140004795 CTCTACTGGGGAGCAGCTGCTGG - Intronic
981568381 4:146125292-146125314 TTGTACTGGGGAGCAGCTTTTGG + Intergenic
981996145 4:150977487-150977509 TACTACTTGGATGTTGCTTCTGG - Intronic
982757970 4:159247121-159247143 TTATAATGGGATGGAGTTTCAGG + Intronic
984022183 4:174499012-174499034 TGCTACTGTGGTGTAGCTTCAGG + Intronic
984352521 4:178613708-178613730 TTCTACTGGGATTTAGCTAAGGG - Intergenic
986983889 5:13478980-13479002 TTCCACCGGGTCGCAGCTTCTGG + Intergenic
987888124 5:23837529-23837551 TTCTACTGGGAAAGAGGTTCTGG + Intergenic
991597562 5:68321207-68321229 GTGAACTGGAATGCAGCTTCGGG + Intergenic
999424254 5:151473356-151473378 TTCTACTTGAATTCAGTTTCTGG + Intronic
1003534819 6:6967589-6967611 TTCTAGTGAGAATCAGCTTCAGG - Intergenic
1003668592 6:8134405-8134427 TGATACTGGGATGCATCTTAGGG + Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007081793 6:39110944-39110966 TTCTTCTTGGATGCTTCTTCTGG - Intronic
1011616018 6:89199112-89199134 TGCCACTGGGATGCATTTTCTGG - Intronic
1013375225 6:109508477-109508499 ATTTACTGGGGAGCAGCTTCTGG - Intronic
1017238073 6:152138145-152138167 TTCTATAGGGATGCACCTTTTGG + Intronic
1017572694 6:155764413-155764435 TTCCTCTGGGATGTATCTTCAGG - Intergenic
1018356843 6:163026872-163026894 TTTTCCTGGGAAGAAGCTTCTGG - Intronic
1024576893 7:50771704-50771726 TCCTACTGGGCTGCGGGTTCTGG - Intronic
1033298895 7:140168261-140168283 TTGTATTGAGATACAGCTTCAGG - Intronic
1039062860 8:33585631-33585653 TTCCACAGGGATGCAGCTAAGGG - Intergenic
1042402834 8:68369701-68369723 TTCTTCTGAGACACAGCTTCTGG - Intronic
1043304962 8:78782829-78782851 TACCCCTGGGATGGAGCTTCTGG - Intronic
1045358382 8:101410104-101410126 CTCTACTAGGCTGGAGCTTCTGG - Intergenic
1045613936 8:103883997-103884019 TTCAACTGTTATGTAGCTTCTGG + Intronic
1048907253 8:139100114-139100136 TTCAACTGGGATGCAGCCAGGGG - Intergenic
1049608750 8:143542230-143542252 TTCGACTGAGCTGCAGCTTCGGG - Intergenic
1051467226 9:17393522-17393544 TTCAACTGGGATCCAAATTCAGG - Intronic
1051873990 9:21771271-21771293 TTCTACTGACAGCCAGCTTCTGG + Intergenic
1053709897 9:40795627-40795649 TTCTACTGTGAATCAACTTCTGG - Intergenic
1054419801 9:64916421-64916443 TTCTACTGTGAATCAACTTCTGG - Intergenic
1058024882 9:100131151-100131173 TTCTACTAGGCTGGAGCTCCAGG + Intronic
1189424107 X:40882653-40882675 GTCTACTGGCATGCAGATTGTGG + Intergenic
1190099145 X:47507789-47507811 TTGTACTGGGATGAACCTTTAGG - Intergenic
1190458272 X:50645869-50645891 CTCTCCTGGGAGCCAGCTTCTGG - Intronic
1194067927 X:89284721-89284743 TGCGACTGGGATGGAGCTCCTGG - Intergenic
1194896455 X:99447440-99447462 ATCTACTGGGCTGCATTTTCAGG + Intergenic
1198566674 X:137912299-137912321 TTTTGCTGGGATCCAGCTTATGG - Intergenic
1198619326 X:138488950-138488972 TTCTACTCAGAAGCAGCTTCTGG - Intergenic
1200722071 Y:6618882-6618904 TGCGACTGGGATGGAGCTCCTGG - Intergenic