ID: 1146278258

View in Genome Browser
Species Human (GRCh38)
Location 17:31529047-31529069
Sequence TGGGAGAACCCAATGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146278258_1146278261 -2 Left 1146278258 17:31529047-31529069 CCTGGAGGCATTGGGTTCTCCCA 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1146278261 17:31529068-31529090 CAGAAGTAGACCCTCACCCAAGG 0: 1
1: 0
2: 0
3: 30
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146278258 Original CRISPR TGGGAGAACCCAATGCCTCC AGG (reversed) Intronic
902163967 1:14554379-14554401 GGTGTGAACCCAAGGCCTCCTGG - Intergenic
905318161 1:37096738-37096760 TGGAAGCAGGCAATGCCTCCTGG - Intergenic
905990449 1:42333622-42333644 TGAGAGAAGCCTATTCCTCCTGG - Intronic
907934165 1:59027391-59027413 TGGGAGAATCCAGTGACTCACGG - Intergenic
909276916 1:73698678-73698700 TGGCATGACCCAAGGCCTCCAGG - Intergenic
915461640 1:156074013-156074035 TGGGGGAACCCGGTCCCTCCTGG - Exonic
918942157 1:191014802-191014824 TGGGAGAATCCCTTGCATCCAGG + Intergenic
921291493 1:213662064-213662086 AGGGAGAACCCAATGTTTCTAGG + Intergenic
922843699 1:228665840-228665862 TGGGAGAAAGCAGTCCCTCCAGG + Intergenic
924218948 1:241853888-241853910 TGGGTGAGACCGATGCCTCCAGG - Intronic
1062779005 10:183886-183908 TGGGAGAAATCAATGGTTCCAGG - Intronic
1063317806 10:5023230-5023252 TGGCAGAATCCAGTGCCTTCCGG + Intronic
1067533904 10:47094189-47094211 TGGAAGAAAGCAATGCCTCTGGG + Intergenic
1067707140 10:48615283-48615305 TGGGAGCACCCCTTGCCCCCAGG + Intronic
1070187180 10:74075685-74075707 TGTGTGACCCCAATGTCTCCAGG + Intronic
1070613381 10:77949792-77949814 TGGGAGAACAGACTGCATCCTGG + Intergenic
1071359154 10:84828443-84828465 TGGCAAAACCCAAGGCCCCCAGG - Intergenic
1075428874 10:122364190-122364212 TGGGAGAAGCCACTGCATCCAGG - Intergenic
1075978752 10:126719417-126719439 TGGGAGAAAGCAATGCCAGCTGG - Intergenic
1076774591 10:132687682-132687704 TGGGAGAACCCAAAGCTGCAGGG - Intronic
1078334033 11:10450399-10450421 TGGAAGAAACCAATGCTTGCGGG + Intronic
1078565075 11:12407704-12407726 AGGGAGAACCTAATACTTCCAGG - Intronic
1080634789 11:34114275-34114297 TGGGAGAACACAATCTCTGCTGG - Intronic
1084456302 11:69269994-69270016 TGGGAGCACACAGGGCCTCCAGG + Intergenic
1086435998 11:86781713-86781735 TGGAGGAACCCACTGCCCCCTGG - Intergenic
1088447712 11:109950107-109950129 TGGAAGTAGCCAAGGCCTCCTGG + Intergenic
1088710115 11:112499984-112500006 TGGGGGAACCCCATGCAGCCAGG + Intergenic
1089153585 11:116384254-116384276 AGGGAGCACCCCATGCTTCCTGG - Intergenic
1090647626 11:128778444-128778466 TGGCAGATCCCACTGCCTCCAGG - Intronic
1091581499 12:1793231-1793253 TGGTAGAACCCAAGGACTTCTGG - Exonic
1091761718 12:3091902-3091924 TGGGAGCTCCCAGTGCCTCTGGG + Intronic
1092131388 12:6115749-6115771 TGGGAGAACCAGCAGCCTCCTGG + Intronic
1092140332 12:6179246-6179268 TGGGAGCACTCAATACCTACGGG - Intergenic
1098799730 12:74939908-74939930 TGGGAGAAGCCAGGGACTCCAGG + Intergenic
1106915163 13:34506045-34506067 TGGGAGAACCCCCTGAATCCAGG + Intergenic
1112290098 13:98138788-98138810 TGGCAGAATTCAGTGCCTCCAGG + Intergenic
1112952677 13:105020530-105020552 TGGTGGAACCCTATGCCTTCTGG + Intergenic
1119068823 14:71559456-71559478 TGGGAGAGTCCAATGCCACTGGG - Intronic
1119780640 14:77274770-77274792 GGGGAGATCCAAATGCCTCCTGG + Intergenic
1121855800 14:97269028-97269050 TGGGTGAACCAAGTGACTCCTGG - Intergenic
1128755259 15:70179359-70179381 TGGGAGAACCACAAGCTTCCCGG + Intergenic
1130574632 15:85081092-85081114 TGGGAGAATCCCCTTCCTCCAGG - Intronic
1134690676 16:16189239-16189261 GGGGAGAACCTAATGCCTCTAGG + Intronic
1140221905 16:73049622-73049644 TGGGAGAAAAGACTGCCTCCAGG + Intronic
1142178243 16:88654879-88654901 TTGGAGAGCCCAAGGCCGCCTGG - Intronic
1144134488 17:12280273-12280295 TGGGAGAAAACAATGTCTGCAGG + Intergenic
1145033922 17:19526801-19526823 TTGGAGATCCCAATGTCTCCTGG + Intronic
1146278258 17:31529047-31529069 TGGGAGAACCCAATGCCTCCAGG - Intronic
1146555699 17:33821861-33821883 TGGGGGAACCCAATACCTGGAGG + Intronic
1152625442 17:81386123-81386145 TGGGACAACCCTAAGACTCCTGG - Intergenic
1154024083 18:10690407-10690429 TGGGAGAACCCAGATTCTCCAGG - Intronic
1161802378 19:6423683-6423705 TGGGCTGTCCCAATGCCTCCGGG - Intronic
1164112074 19:22174926-22174948 TGGGAGAAGCCAATGACTTTAGG + Intergenic
1165318871 19:35074075-35074097 TGGGAGACCCCCAGGCCCCCTGG + Intergenic
1167972090 19:53194087-53194109 TGGGAAAACCCAGTACCTCTGGG + Intergenic
925036778 2:692967-692989 TGGGAGGAGCCACTGCCTACAGG - Intergenic
925876984 2:8319991-8320013 TGGGTCAACCTGATGCCTCCTGG - Intergenic
926605774 2:14897092-14897114 TGGGAAAAACGAAGGCCTCCAGG + Intergenic
927154192 2:20212385-20212407 TGGGGGAGCCCAGTGTCTCCTGG - Intronic
929421257 2:41792200-41792222 TGGGAGATTCCAAAGCCTTCAGG - Intergenic
934554169 2:95278645-95278667 TGGGAGACCCCAAAGTCACCAGG - Intronic
935756959 2:106283812-106283834 GGGGAGCACCCACTGACTCCTGG + Intergenic
936112605 2:109677224-109677246 GGGGAGCACCCACTGACTCCTGG - Intergenic
936539368 2:113337518-113337540 TGGGAGCACCCCAGGCTTCCTGG + Intergenic
938419499 2:131132994-131133016 AGGGAGAACCCTGAGCCTCCAGG + Exonic
942085754 2:172442249-172442271 TGGGTGAACCCAGCTCCTCCCGG + Intronic
943099214 2:183467996-183468018 TGTGAGAACCCATTGGCTGCTGG + Intergenic
944052699 2:195489408-195489430 TGAAAGAACCCAATGCCGACAGG + Intergenic
947820553 2:233066179-233066201 TGGGAGAACCACCTGACTCCAGG - Intronic
948421135 2:237860636-237860658 TGGGAGAACCCAGTGTCCCTGGG + Intronic
948564379 2:238874461-238874483 TGGGATAACACAACGTCTCCTGG - Intronic
1169199874 20:3703707-3703729 TGGCATAACCCAGTGCTTCCTGG - Intronic
1169471666 20:5891219-5891241 TGGTAGAAACCCATGCCTCCTGG + Intergenic
1171402030 20:24879941-24879963 TGGAAGAACACAAGGCCTCCAGG - Intergenic
1174176789 20:48650393-48650415 TGGAGGAACCCAAGGCCTCGGGG + Intronic
1175618621 20:60424401-60424423 TGGGAGAGGCCAAAGCCTGCAGG + Intergenic
1175990192 20:62784839-62784861 TGGCAGAAACCCAGGCCTCCCGG + Intergenic
1176034702 20:63030557-63030579 TGGCAGAGCCCAGTGCCTGCTGG + Intergenic
1181001310 22:19988990-19989012 TGGGAGGACCCAAGGCACCCCGG - Intronic
1181392787 22:22595598-22595620 TGTGAGAAGCCAGGGCCTCCCGG - Intergenic
1181910318 22:26233467-26233489 TCATAGAACCCCATGCCTCCTGG + Intronic
1183727770 22:39598913-39598935 AGGCAGAAAGCAATGCCTCCCGG - Intronic
1184067095 22:42127199-42127221 TTGGAGGACCCAACGCCTGCAGG - Intronic
950007479 3:9700732-9700754 TGGAAGAACCCACTGTCTGCTGG - Intronic
950408216 3:12817530-12817552 TGGGTGACCCCAAAGCTTCCAGG - Exonic
950640829 3:14347046-14347068 TGGGCTGACCCCATGCCTCCGGG + Intergenic
951645397 3:24884989-24885011 TGGCAGAACGTAATGACTCCAGG + Intergenic
951723104 3:25722802-25722824 TGGGTGAAACTAATGACTCCCGG - Intronic
953635308 3:44658485-44658507 TGGCAGAACCCACTGACTCGTGG - Intronic
954257172 3:49414975-49414997 AGGGAGTACCCAGTGCCTACAGG + Exonic
955415452 3:58687168-58687190 TGTGAGAACTCACTTCCTCCAGG + Intergenic
962434170 3:135349038-135349060 CAGGAGAACCCAAGGTCTCCAGG - Intergenic
968702211 4:2062489-2062511 TGGGAGACCCCAGGGGCTCCAGG + Intronic
974258028 4:59487571-59487593 TTGAAGAACCCACTGCTTCCAGG + Intergenic
976566856 4:86561079-86561101 TAGGAGAATCCAATGCCTGATGG - Intronic
977561671 4:98539299-98539321 TGGGAGAAGCTCATGGCTCCTGG - Intronic
985815479 5:2125122-2125144 TGCTAGAACCCACAGCCTCCCGG - Intergenic
987577703 5:19752382-19752404 TGGGAGAAGCCTGTGACTCCCGG + Intronic
996399255 5:123043399-123043421 TAGGAGACCCTAGTGCCTCCTGG - Intergenic
998395664 5:141816373-141816395 TTGGACAAGCCACTGCCTCCCGG - Intergenic
998409519 5:141898870-141898892 CAGGAGAACCCCATGTCTCCAGG + Intergenic
1001640829 5:173242950-173242972 TGGGAGGACCAAATGCTCCCTGG - Intergenic
1011055290 6:83197593-83197615 TAGGAGAATGGAATGCCTCCCGG - Exonic
1017625751 6:156346970-156346992 TGGGAGTACCCAAAGCATCGTGG + Intergenic
1021295525 7:18901524-18901546 TGGGAGAATCCAATGCCTGTAGG + Intronic
1021556076 7:21919512-21919534 TCGGAGAACACAATGCATCTCGG + Intronic
1022084610 7:27054939-27054961 TGGGAGAACCCATTGAGCCCAGG + Intergenic
1023941735 7:44772723-44772745 TGGGAGAACCCTCTGCCTCCAGG + Intergenic
1024915600 7:54495636-54495658 TGAGAGATCCCAATACCTCTGGG - Intergenic
1026493918 7:70886732-70886754 TGGCAGGCCCCAGTGCCTCCTGG - Intergenic
1031765341 7:125770751-125770773 TGGGAGAAGCCATTTCCTCATGG - Intergenic
1033844220 7:145412762-145412784 TGTGAGAACCAAATGCATCTAGG - Intergenic
1036373249 8:8178593-8178615 AGGGAGAAGCCAACCCCTCCTGG + Intergenic
1039608840 8:38903137-38903159 TTGGAGAACCAAATCCCTACAGG - Intronic
1040864220 8:52032034-52032056 TGGGAGCACCCAGTGCCAACGGG - Intergenic
1041930746 8:63283939-63283961 TGGGAGCTCCCAGTGCCTCCTGG - Intergenic
1042398153 8:68314900-68314922 TGTGAGAAACCCATGCCTCAGGG - Intronic
1042871279 8:73401958-73401980 TCGGGTAACACAATGCCTCCAGG - Intergenic
1044587603 8:93882759-93882781 TGAGTGAACACGATGCCTCCAGG - Intronic
1045384488 8:101658192-101658214 TGGCAGAAACCTCTGCCTCCAGG - Intronic
1049432982 8:142573845-142573867 TGGGTGGCCCCAATGCCTCACGG + Intergenic
1050537948 9:6645994-6646016 TGGGACAGCCCAAAGACTCCGGG + Intergenic
1051172316 9:14331076-14331098 TGGGAGAAACCATTGCCCCAGGG - Intronic
1051670582 9:19505559-19505581 TTGGAAAACCCAAAGCCTGCTGG - Intergenic
1057121959 9:92584220-92584242 TGGGAAAAGCCAATGCATGCTGG - Intronic
1058627663 9:106951955-106951977 TGGGTGAAAACAATCCCTCCTGG - Intronic
1059823145 9:117996395-117996417 TTGCAGAACTCAATGCATCCTGG - Intergenic
1062288597 9:135784703-135784725 TGGCAGCACCCAGAGCCTCCTGG - Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1186499991 X:10043559-10043581 TGGGAGAACCCGGTGCCCTCAGG - Intronic
1190539802 X:51465410-51465432 TGGCAGTACTCAATGTCTCCAGG - Intergenic
1191937488 X:66440915-66440937 TAGGTGAACCCAAAGTCTCCCGG + Intergenic
1193632962 X:83912179-83912201 TGGGAAGACACAGTGCCTCCTGG - Intergenic
1194054884 X:89119514-89119536 TGAGAGAGCCCCATGTCTCCAGG - Intergenic
1199158410 X:144577458-144577480 TGGGAGAACCCATTGAGTTCAGG - Intergenic