ID: 1146283077

View in Genome Browser
Species Human (GRCh38)
Location 17:31557984-31558006
Sequence TGGGAGGATCGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146283077 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr