ID: 1146283503

View in Genome Browser
Species Human (GRCh38)
Location 17:31559736-31559758
Sequence CTGGGGGAGGGGGAGGTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146283503_1146283511 -10 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283511 17:31559749-31559771 CCTCCCCCAGCGCTGTCCCTCGG No data
1146283503_1146283520 10 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283520 17:31559769-31559791 CGGCCTGAGCCGAGGCGGCCCGG No data
1146283503_1146283516 2 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283516 17:31559761-31559783 CTGTCCCTCGGCCTGAGCCGAGG No data
1146283503_1146283527 21 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283527 17:31559780-31559802 GAGGCGGCCCGGGGGTGGCGTGG No data
1146283503_1146283525 16 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283525 17:31559775-31559797 GAGCCGAGGCGGCCCGGGGGTGG No data
1146283503_1146283517 5 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283517 17:31559764-31559786 TCCCTCGGCCTGAGCCGAGGCGG No data
1146283503_1146283524 13 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283524 17:31559772-31559794 CCTGAGCCGAGGCGGCCCGGGGG No data
1146283503_1146283528 24 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283528 17:31559783-31559805 GCGGCCCGGGGGTGGCGTGGAGG No data
1146283503_1146283521 11 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283521 17:31559770-31559792 GGCCTGAGCCGAGGCGGCCCGGG No data
1146283503_1146283522 12 Left 1146283503 17:31559736-31559758 CCCCGCACCTCCCCCTCCCCCAG No data
Right 1146283522 17:31559771-31559793 GCCTGAGCCGAGGCGGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146283503 Original CRISPR CTGGGGGAGGGGGAGGTGCG GGG (reversed) Intergenic
No off target data available for this crispr