ID: 1146283824

View in Genome Browser
Species Human (GRCh38)
Location 17:31561095-31561117
Sequence TACTGTTGTCCCTGTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146283813_1146283824 28 Left 1146283813 17:31561044-31561066 CCTGCCTCTGCAGGCCACGTGTA No data
Right 1146283824 17:31561095-31561117 TACTGTTGTCCCTGTTTTGGGGG No data
1146283814_1146283824 24 Left 1146283814 17:31561048-31561070 CCTCTGCAGGCCACGTGTAGAGT No data
Right 1146283824 17:31561095-31561117 TACTGTTGTCCCTGTTTTGGGGG No data
1146283817_1146283824 -2 Left 1146283817 17:31561074-31561096 CCTTTGCAGGCGTCCTGCCCATA No data
Right 1146283824 17:31561095-31561117 TACTGTTGTCCCTGTTTTGGGGG No data
1146283815_1146283824 14 Left 1146283815 17:31561058-31561080 CCACGTGTAGAGTAGTCCTTTGC No data
Right 1146283824 17:31561095-31561117 TACTGTTGTCCCTGTTTTGGGGG No data
1146283812_1146283824 29 Left 1146283812 17:31561043-31561065 CCCTGCCTCTGCAGGCCACGTGT No data
Right 1146283824 17:31561095-31561117 TACTGTTGTCCCTGTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146283824 Original CRISPR TACTGTTGTCCCTGTTTTGG GGG Intergenic
No off target data available for this crispr