ID: 1146284742

View in Genome Browser
Species Human (GRCh38)
Location 17:31566841-31566863
Sequence CCATCACCAGACACAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146284742_1146284745 -1 Left 1146284742 17:31566841-31566863 CCTCCTTCTGTGTCTGGTGATGG No data
Right 1146284745 17:31566863-31566885 GCAAACGTTTATCTTTGCTCAGG No data
1146284742_1146284746 4 Left 1146284742 17:31566841-31566863 CCTCCTTCTGTGTCTGGTGATGG No data
Right 1146284746 17:31566868-31566890 CGTTTATCTTTGCTCAGGCCTGG No data
1146284742_1146284747 5 Left 1146284742 17:31566841-31566863 CCTCCTTCTGTGTCTGGTGATGG No data
Right 1146284747 17:31566869-31566891 GTTTATCTTTGCTCAGGCCTGGG No data
1146284742_1146284748 21 Left 1146284742 17:31566841-31566863 CCTCCTTCTGTGTCTGGTGATGG No data
Right 1146284748 17:31566885-31566907 GCCTGGGTGCACGCTAACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146284742 Original CRISPR CCATCACCAGACACAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr