ID: 1146289926

View in Genome Browser
Species Human (GRCh38)
Location 17:31599547-31599569
Sequence CAGGAGCACAGGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146289913_1146289926 29 Left 1146289913 17:31599495-31599517 CCAAATGTGGTCAGGGGGGTTTG No data
Right 1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG No data
1146289912_1146289926 30 Left 1146289912 17:31599494-31599516 CCCAAATGTGGTCAGGGGGGTTT No data
Right 1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146289926 Original CRISPR CAGGAGCACAGGAGGGCAGT GGG Intergenic
No off target data available for this crispr