ID: 1146295204

View in Genome Browser
Species Human (GRCh38)
Location 17:31644474-31644496
Sequence TAGGGGTGAGCCACGACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146295204_1146295208 -5 Left 1146295204 17:31644474-31644496 CCAAGTGTCGTGGCTCACCCCTA No data
Right 1146295208 17:31644492-31644514 CCCTATAACTGCAGCACTTTGGG No data
1146295204_1146295206 -6 Left 1146295204 17:31644474-31644496 CCAAGTGTCGTGGCTCACCCCTA No data
Right 1146295206 17:31644491-31644513 CCCCTATAACTGCAGCACTTTGG No data
1146295204_1146295211 18 Left 1146295204 17:31644474-31644496 CCAAGTGTCGTGGCTCACCCCTA No data
Right 1146295211 17:31644515-31644537 AGGCTAAGTCCTGTGCAACGTGG No data
1146295204_1146295210 -2 Left 1146295204 17:31644474-31644496 CCAAGTGTCGTGGCTCACCCCTA No data
Right 1146295210 17:31644495-31644517 TATAACTGCAGCACTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146295204 Original CRISPR TAGGGGTGAGCCACGACACT TGG (reversed) Intergenic
No off target data available for this crispr