ID: 1146295205

View in Genome Browser
Species Human (GRCh38)
Location 17:31644491-31644513
Sequence CCAAAGTGCTGCAGTTATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146295205_1146295211 1 Left 1146295205 17:31644491-31644513 CCCCTATAACTGCAGCACTTTGG No data
Right 1146295211 17:31644515-31644537 AGGCTAAGTCCTGTGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146295205 Original CRISPR CCAAAGTGCTGCAGTTATAG GGG (reversed) Intergenic
No off target data available for this crispr