ID: 1146295207

View in Genome Browser
Species Human (GRCh38)
Location 17:31644492-31644514
Sequence CCCAAAGTGCTGCAGTTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146295207_1146295211 0 Left 1146295207 17:31644492-31644514 CCCTATAACTGCAGCACTTTGGG No data
Right 1146295211 17:31644515-31644537 AGGCTAAGTCCTGTGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146295207 Original CRISPR CCCAAAGTGCTGCAGTTATA GGG (reversed) Intergenic
No off target data available for this crispr