ID: 1146295209

View in Genome Browser
Species Human (GRCh38)
Location 17:31644493-31644515
Sequence TCCCAAAGTGCTGCAGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413713
Summary {0: 6, 1: 123, 2: 3196, 3: 52194, 4: 358194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146295209_1146295211 -1 Left 1146295209 17:31644493-31644515 CCTATAACTGCAGCACTTTGGGA 0: 6
1: 123
2: 3196
3: 52194
4: 358194
Right 1146295211 17:31644515-31644537 AGGCTAAGTCCTGTGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146295209 Original CRISPR TCCCAAAGTGCTGCAGTTAT AGG (reversed) Intergenic
Too many off-targets to display for this crispr