ID: 1146295211

View in Genome Browser
Species Human (GRCh38)
Location 17:31644515-31644537
Sequence AGGCTAAGTCCTGTGCAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146295207_1146295211 0 Left 1146295207 17:31644492-31644514 CCCTATAACTGCAGCACTTTGGG No data
Right 1146295211 17:31644515-31644537 AGGCTAAGTCCTGTGCAACGTGG No data
1146295209_1146295211 -1 Left 1146295209 17:31644493-31644515 CCTATAACTGCAGCACTTTGGGA 0: 6
1: 123
2: 3196
3: 52194
4: 358194
Right 1146295211 17:31644515-31644537 AGGCTAAGTCCTGTGCAACGTGG No data
1146295205_1146295211 1 Left 1146295205 17:31644491-31644513 CCCCTATAACTGCAGCACTTTGG No data
Right 1146295211 17:31644515-31644537 AGGCTAAGTCCTGTGCAACGTGG No data
1146295204_1146295211 18 Left 1146295204 17:31644474-31644496 CCAAGTGTCGTGGCTCACCCCTA No data
Right 1146295211 17:31644515-31644537 AGGCTAAGTCCTGTGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146295211 Original CRISPR AGGCTAAGTCCTGTGCAACG TGG Intergenic
No off target data available for this crispr