ID: 1146297657

View in Genome Browser
Species Human (GRCh38)
Location 17:31662205-31662227
Sequence CTGAGTGTCTGGAGCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146297651_1146297657 19 Left 1146297651 17:31662163-31662185 CCTGTGCTATGCCAAGCTGGGGG No data
Right 1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG No data
1146297654_1146297657 8 Left 1146297654 17:31662174-31662196 CCAAGCTGGGGGCAGTGAGGAGG No data
Right 1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146297657 Original CRISPR CTGAGTGTCTGGAGCTCAGA TGG Intergenic
No off target data available for this crispr